Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805049102:

Variant ID: vg0805049102 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5049102
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTATCACATGTTTGACCGTTCGTCTTATTCAAGAACTTTTATGAGATATGTAAAATTATATGTCTACATAAAAATATATTTAACAATGAATCAAATG[A/G]
TAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGGCATCAAACATTTCGAACGGAGGGAGT

Reverse complement sequence

ACTCCCTCCGTTCGAAATGTTTGATGCCGTTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTA[T/C]
CATTTGATTCATTGTTAAATATATTTTTATGTAGACATATAATTTTACATATCTCATAAAAGTTCTTGAATAAGACGAACGGTCAAACATGTGATAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 2.60% 0.97% 42.42% NA
All Indica  2759 56.90% 0.10% 0.36% 42.59% NA
All Japonica  1512 53.60% 7.70% 2.38% 36.38% NA
Aus  269 38.70% 0.00% 0.00% 61.34% NA
Indica I  595 92.40% 0.00% 0.34% 7.23% NA
Indica II  465 32.30% 0.00% 0.86% 66.88% NA
Indica III  913 44.90% 0.20% 0.22% 54.65% NA
Indica Intermediate  786 58.50% 0.30% 0.25% 40.97% NA
Temperate Japonica  767 87.60% 0.90% 1.83% 9.65% NA
Tropical Japonica  504 7.90% 14.70% 3.37% 74.01% NA
Japonica Intermediate  241 40.70% 14.50% 2.07% 42.74% NA
VI/Aromatic  96 27.10% 0.00% 0.00% 72.92% NA
Intermediate  90 47.80% 2.20% 0.00% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805049102 A -> G LOC_Os08g08710.1 upstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:48.104; most accessible tissue: Zhenshan97 root, score: 97.198 N N N N
vg0805049102 A -> G LOC_Os08g08720.1 upstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:48.104; most accessible tissue: Zhenshan97 root, score: 97.198 N N N N
vg0805049102 A -> G LOC_Os08g08710-LOC_Os08g08720 intergenic_region ; MODIFIER silent_mutation Average:48.104; most accessible tissue: Zhenshan97 root, score: 97.198 N N N N
vg0805049102 A -> DEL N N silent_mutation Average:48.104; most accessible tissue: Zhenshan97 root, score: 97.198 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805049102 A G -0.02 -0.01 0.0 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805049102 NA 8.10E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049102 NA 7.95E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049102 7.74E-06 5.33E-09 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049102 1.89E-06 1.89E-06 mr1362 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251