\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805022482:

Variant ID: vg0805022482 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5022482
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, G: 0.39, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAATCTTATATTAAAAATCTAATAATCTTATATTAAAAATCTAACAATCATATCTTTACATTACTTGCCTGCGCGAATTCCTTCGAGGGCTAGCTAC[G/C]
ACTTCGGCTTGAGGGACGACGACGACGACGTCTTTTCTGCAACATGCAAAAAAAAATGTATTAGTCTAAACGCAAAGGAACATATATTGTATTTCACGTT

Reverse complement sequence

AACGTGAAATACAATATATGTTCCTTTGCGTTTAGACTAATACATTTTTTTTTGCATGTTGCAGAAAAGACGTCGTCGTCGTCGTCCCTCAAGCCGAAGT[C/G]
GTAGCTAGCCCTCGAAGGAATTCGCGCAGGCAAGTAATGTAAAGATATGATTGTTAGATTTTTAATATAAGATTATTAGATTTTTAATATAAGATTATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 20.00% 0.13% 39.55% NA
All Indica  2759 54.90% 3.50% 0.14% 41.43% NA
All Japonica  1512 13.40% 52.10% 0.13% 34.39% NA
Aus  269 45.70% 9.70% 0.00% 44.61% NA
Indica I  595 90.10% 2.70% 0.00% 7.23% NA
Indica II  465 24.50% 7.10% 0.22% 68.17% NA
Indica III  913 46.50% 0.80% 0.11% 52.57% NA
Indica Intermediate  786 56.00% 5.20% 0.25% 38.55% NA
Temperate Japonica  767 1.40% 87.60% 0.00% 10.95% NA
Tropical Japonica  504 23.60% 5.20% 0.20% 71.03% NA
Japonica Intermediate  241 29.90% 37.30% 0.41% 32.37% NA
VI/Aromatic  96 30.20% 18.80% 0.00% 51.04% NA
Intermediate  90 43.30% 15.60% 0.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805022482 G -> C LOC_Os08g08670.1 upstream_gene_variant ; 1020.0bp to feature; MODIFIER silent_mutation Average:13.82; most accessible tissue: Callus, score: 25.068 N N N N
vg0805022482 G -> C LOC_Os08g08680.1 downstream_gene_variant ; 1997.0bp to feature; MODIFIER silent_mutation Average:13.82; most accessible tissue: Callus, score: 25.068 N N N N
vg0805022482 G -> C LOC_Os08g08670-LOC_Os08g08680 intergenic_region ; MODIFIER silent_mutation Average:13.82; most accessible tissue: Callus, score: 25.068 N N N N
vg0805022482 G -> DEL N N silent_mutation Average:13.82; most accessible tissue: Callus, score: 25.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805022482 NA 5.98E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 3.63E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 4.05E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 2.41E-07 2.41E-07 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 3.59E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 4.40E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 1.88E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 5.98E-06 5.98E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 6.31E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 NA 1.63E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482 4.05E-06 NA mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251