Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805022482:

Variant ID: vg0805022482 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5022482
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, G: 0.39, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAATCTTATATTAAAAATCTAATAATCTTATATTAAAAATCTAACAATCATATCTTTACATTACTTGCCTGCGCGAATTCCTTCGAGGGCTAGCTAC[G/C]
ACTTCGGCTTGAGGGACGACGACGACGACGTCTTTTCTGCAACATGCAAAAAAAAATGTATTAGTCTAAACGCAAAGGAACATATATTGTATTTCACGTT

Reverse complement sequence

AACGTGAAATACAATATATGTTCCTTTGCGTTTAGACTAATACATTTTTTTTTGCATGTTGCAGAAAAGACGTCGTCGTCGTCGTCCCTCAAGCCGAAGT[C/G]
GTAGCTAGCCCTCGAAGGAATTCGCGCAGGCAAGTAATGTAAAGATATGATTGTTAGATTTTTAATATAAGATTATTAGATTTTTAATATAAGATTATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	20.00%	0.13%	39.55%	NA
All Indica	2759	54.90%	3.50%	0.14%	41.43%	NA
All Japonica	1512	13.40%	52.10%	0.13%	34.39%	NA
Aus	269	45.70%	9.70%	0.00%	44.61%	NA
Indica I	595	90.10%	2.70%	0.00%	7.23%	NA
Indica II	465	24.50%	7.10%	0.22%	68.17%	NA
Indica III	913	46.50%	0.80%	0.11%	52.57%	NA
Indica Intermediate	786	56.00%	5.20%	0.25%	38.55%	NA
Temperate Japonica	767	1.40%	87.60%	0.00%	10.95%	NA
Tropical Japonica	504	23.60%	5.20%	0.20%	71.03%	NA
Japonica Intermediate	241	29.90%	37.30%	0.41%	32.37%	NA
VI/Aromatic	96	30.20%	18.80%	0.00%	51.04%	NA
Intermediate	90	43.30%	15.60%	0.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805022482	G -> C	LOC_Os08g08670.1	upstream_gene_variant ; 1020.0bp to feature; MODIFIER	silent_mutation	Average:13.82; most accessible tissue: Callus, score: 25.068	N	N	N	N
vg0805022482	G -> C	LOC_Os08g08680.1	downstream_gene_variant ; 1997.0bp to feature; MODIFIER	silent_mutation	Average:13.82; most accessible tissue: Callus, score: 25.068	N	N	N	N
vg0805022482	G -> C	LOC_Os08g08670-LOC_Os08g08680	intergenic_region ; MODIFIER	silent_mutation	Average:13.82; most accessible tissue: Callus, score: 25.068	N	N	N	N
vg0805022482	G -> DEL	N	N	silent_mutation	Average:13.82; most accessible tissue: Callus, score: 25.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805022482	NA	5.98E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	3.63E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	4.05E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	2.41E-07	2.41E-07	mr1373_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	3.59E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	4.40E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	1.88E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	5.98E-06	5.98E-06	mr1760_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	6.31E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	NA	1.63E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805022482	4.05E-06	NA	mr1966_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251