\
| Variant ID: vg0805022482 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5022482 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, G: 0.39, others allele: 0.00, population size: 72. )
TAATAATCTTATATTAAAAATCTAATAATCTTATATTAAAAATCTAACAATCATATCTTTACATTACTTGCCTGCGCGAATTCCTTCGAGGGCTAGCTAC[G/C]
ACTTCGGCTTGAGGGACGACGACGACGACGTCTTTTCTGCAACATGCAAAAAAAAATGTATTAGTCTAAACGCAAAGGAACATATATTGTATTTCACGTT
AACGTGAAATACAATATATGTTCCTTTGCGTTTAGACTAATACATTTTTTTTTGCATGTTGCAGAAAAGACGTCGTCGTCGTCGTCCCTCAAGCCGAAGT[C/G]
GTAGCTAGCCCTCGAAGGAATTCGCGCAGGCAAGTAATGTAAAGATATGATTGTTAGATTTTTAATATAAGATTATTAGATTTTTAATATAAGATTATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 20.00% | 0.13% | 39.55% | NA |
| All Indica | 2759 | 54.90% | 3.50% | 0.14% | 41.43% | NA |
| All Japonica | 1512 | 13.40% | 52.10% | 0.13% | 34.39% | NA |
| Aus | 269 | 45.70% | 9.70% | 0.00% | 44.61% | NA |
| Indica I | 595 | 90.10% | 2.70% | 0.00% | 7.23% | NA |
| Indica II | 465 | 24.50% | 7.10% | 0.22% | 68.17% | NA |
| Indica III | 913 | 46.50% | 0.80% | 0.11% | 52.57% | NA |
| Indica Intermediate | 786 | 56.00% | 5.20% | 0.25% | 38.55% | NA |
| Temperate Japonica | 767 | 1.40% | 87.60% | 0.00% | 10.95% | NA |
| Tropical Japonica | 504 | 23.60% | 5.20% | 0.20% | 71.03% | NA |
| Japonica Intermediate | 241 | 29.90% | 37.30% | 0.41% | 32.37% | NA |
| VI/Aromatic | 96 | 30.20% | 18.80% | 0.00% | 51.04% | NA |
| Intermediate | 90 | 43.30% | 15.60% | 0.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805022482 | G -> C | LOC_Os08g08670.1 | upstream_gene_variant ; 1020.0bp to feature; MODIFIER | silent_mutation | Average:13.82; most accessible tissue: Callus, score: 25.068 | N | N | N | N |
| vg0805022482 | G -> C | LOC_Os08g08680.1 | downstream_gene_variant ; 1997.0bp to feature; MODIFIER | silent_mutation | Average:13.82; most accessible tissue: Callus, score: 25.068 | N | N | N | N |
| vg0805022482 | G -> C | LOC_Os08g08670-LOC_Os08g08680 | intergenic_region ; MODIFIER | silent_mutation | Average:13.82; most accessible tissue: Callus, score: 25.068 | N | N | N | N |
| vg0805022482 | G -> DEL | N | N | silent_mutation | Average:13.82; most accessible tissue: Callus, score: 25.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805022482 | NA | 5.98E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 3.63E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 4.05E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | 2.41E-07 | 2.41E-07 | mr1373_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 3.59E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 4.40E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 1.88E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | 5.98E-06 | 5.98E-06 | mr1760_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 6.31E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | NA | 1.63E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805022482 | 4.05E-06 | NA | mr1966_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |