Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805005643:

Variant ID: vg0805005643 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5005643
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGCAAGCCACCACAGCAACAATGCACATGACAGGGGTATTCAAAGGATGGCTATGGTTCTTTTTGCGCAAAGCAGGTTTTGTAATTCTTTTCACAAGC[C/T,A]
TAAGACCTAGCACAGACTGATCAAATTTTTGTACCAGTGTTCATATTAAACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCG

Reverse complement sequence

CGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGTTTAATATGAACACTGGTACAAAAATTTGATCAGTCTGTGCTAGGTCTTA[G/A,T]
GCTTGTGAAAAGAATTACAAAACCTGCTTTGCGCAAAAAGAACCATAGCCATCCTTTGAATACCCCTGTCATGTGCATTGTTGCTGTGGTGGCTTGCTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	3.00%	17.46%	3.20%	A: 0.02%
All Indica	2759	82.10%	0.20%	16.38%	1.27%	A: 0.04%
All Japonica	1512	67.40%	8.70%	16.73%	7.21%	NA
Aus	269	61.70%	0.40%	36.06%	1.86%	NA
Indica I	595	98.20%	0.00%	1.85%	0.00%	NA
Indica II	465	81.50%	0.20%	16.99%	1.29%	NA
Indica III	913	70.60%	0.20%	26.62%	2.52%	NA
Indica Intermediate	786	83.70%	0.30%	15.14%	0.76%	A: 0.13%
Temperate Japonica	767	95.00%	0.90%	3.00%	1.04%	NA
Tropical Japonica	504	33.50%	11.50%	37.70%	17.26%	NA
Japonica Intermediate	241	50.20%	27.40%	16.60%	5.81%	NA
VI/Aromatic	96	89.60%	3.10%	7.29%	0.00%	NA
Intermediate	90	76.70%	3.30%	17.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805005643	C -> T	LOC_Os08g08650.1	upstream_gene_variant ; 3508.0bp to feature; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> T	LOC_Os08g08650.2	upstream_gene_variant ; 3508.0bp to feature; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> T	LOC_Os08g08650-LOC_Os08g08655	intergenic_region ; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> A	LOC_Os08g08650.1	upstream_gene_variant ; 3508.0bp to feature; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> A	LOC_Os08g08650.2	upstream_gene_variant ; 3508.0bp to feature; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> A	LOC_Os08g08650-LOC_Os08g08655	intergenic_region ; MODIFIER	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0805005643	C -> DEL	N	N	silent_mutation	Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805005643	4.74E-08	4.73E-08	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.12E-06	3.12E-06	mr1184_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.19E-07	1.19E-07	mr1192_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	7.65E-06	7.65E-06	mr1245_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	2.55E-06	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	6.34E-07	6.34E-07	mr1278_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.46E-07	1.46E-07	mr1284_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	4.35E-08	4.35E-08	mr1286_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	4.66E-06	4.66E-06	mr1311_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	6.20E-10	6.20E-10	mr1312_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.77E-06	1.77E-06	mr1369_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.56E-09	2.56E-09	mr1373_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.41E-07	1.41E-07	mr1374_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.12E-08	1.13E-09	mr1397_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.48E-07	3.48E-07	mr1412_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.88E-06	2.36E-07	mr1417_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.09E-06	3.09E-06	mr1427_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.04E-06	2.04E-06	mr1453_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	9.69E-06	mr1467_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.08E-06	1.08E-06	mr1485_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	3.33E-07	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	7.11E-06	7.11E-06	mr1634_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	4.95E-06	4.95E-06	mr1652_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.71E-08	2.71E-08	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	9.73E-07	1.40E-08	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	4.92E-07	4.91E-07	mr1674_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	8.95E-07	mr1683_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.62E-07	2.62E-07	mr1687_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	1.71E-07	1.71E-07	mr1688_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.04E-06	2.04E-06	mr1700_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	4.63E-06	1.92E-08	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	6.94E-07	6.93E-07	mr1753_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	2.72E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.07E-06	2.07E-06	mr1760_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	4.21E-07	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	2.16E-07	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	1.85E-06	mr1816_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	6.81E-07	6.81E-07	mr1822_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.13E-07	2.13E-07	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.66E-06	1.05E-07	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	2.39E-07	2.39E-07	mr1843_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.43E-08	3.43E-08	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	NA	6.41E-07	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	6.01E-06	NA	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643	3.66E-06	3.66E-06	mr1970_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251