\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805005643:

Variant ID: vg0805005643 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5005643
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGCAAGCCACCACAGCAACAATGCACATGACAGGGGTATTCAAAGGATGGCTATGGTTCTTTTTGCGCAAAGCAGGTTTTGTAATTCTTTTCACAAGC[C/T,A]
TAAGACCTAGCACAGACTGATCAAATTTTTGTACCAGTGTTCATATTAAACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCG

Reverse complement sequence

CGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGTTTAATATGAACACTGGTACAAAAATTTGATCAGTCTGTGCTAGGTCTTA[G/A,T]
GCTTGTGAAAAGAATTACAAAACCTGCTTTGCGCAAAAAGAACCATAGCCATCCTTTGAATACCCCTGTCATGTGCATTGTTGCTGTGGTGGCTTGCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 3.00% 17.46% 3.20% A: 0.02%
All Indica  2759 82.10% 0.20% 16.38% 1.27% A: 0.04%
All Japonica  1512 67.40% 8.70% 16.73% 7.21% NA
Aus  269 61.70% 0.40% 36.06% 1.86% NA
Indica I  595 98.20% 0.00% 1.85% 0.00% NA
Indica II  465 81.50% 0.20% 16.99% 1.29% NA
Indica III  913 70.60% 0.20% 26.62% 2.52% NA
Indica Intermediate  786 83.70% 0.30% 15.14% 0.76% A: 0.13%
Temperate Japonica  767 95.00% 0.90% 3.00% 1.04% NA
Tropical Japonica  504 33.50% 11.50% 37.70% 17.26% NA
Japonica Intermediate  241 50.20% 27.40% 16.60% 5.81% NA
VI/Aromatic  96 89.60% 3.10% 7.29% 0.00% NA
Intermediate  90 76.70% 3.30% 17.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805005643 C -> T LOC_Os08g08650.1 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> T LOC_Os08g08650.2 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> T LOC_Os08g08650-LOC_Os08g08655 intergenic_region ; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> A LOC_Os08g08650.1 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> A LOC_Os08g08650.2 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> A LOC_Os08g08650-LOC_Os08g08655 intergenic_region ; MODIFIER silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0805005643 C -> DEL N N silent_mutation Average:40.441; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805005643 4.74E-08 4.73E-08 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.12E-06 3.12E-06 mr1184_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.19E-07 1.19E-07 mr1192_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 7.65E-06 7.65E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 2.55E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 6.34E-07 6.34E-07 mr1278_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.46E-07 1.46E-07 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 4.35E-08 4.35E-08 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 4.66E-06 4.66E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 6.20E-10 6.20E-10 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.77E-06 1.77E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.56E-09 2.56E-09 mr1373_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.41E-07 1.41E-07 mr1374_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.12E-08 1.13E-09 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.48E-07 3.48E-07 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.88E-06 2.36E-07 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.09E-06 3.09E-06 mr1427_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.04E-06 2.04E-06 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 9.69E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.08E-06 1.08E-06 mr1485_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 3.33E-07 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 7.11E-06 7.11E-06 mr1634_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 4.95E-06 4.95E-06 mr1652_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.71E-08 2.71E-08 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 9.73E-07 1.40E-08 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 4.92E-07 4.91E-07 mr1674_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 8.95E-07 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.62E-07 2.62E-07 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 1.71E-07 1.71E-07 mr1688_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.04E-06 2.04E-06 mr1700_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 4.63E-06 1.92E-08 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 6.94E-07 6.93E-07 mr1753_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 2.72E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.07E-06 2.07E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 4.21E-07 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 2.16E-07 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 1.85E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 6.81E-07 6.81E-07 mr1822_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.13E-07 2.13E-07 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.66E-06 1.05E-07 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 2.39E-07 2.39E-07 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.43E-08 3.43E-08 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 NA 6.41E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 6.01E-06 NA mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805005643 3.66E-06 3.66E-06 mr1970_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251