\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804997889:

Variant ID: vg0804997889 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4997889
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTACATCATAAAGCTCATCATGAGCTCGTGATCTCGTGATCTCATGATCTCAGTATGTTTTTTTTTAATCGATCTCAGTATGTTTTTTAGATCAATTT[T/C]
TTTTATGATTTTGTAAAAAGTACCTCATTTTCATATGACTGTATTTTCTATATTCTTGTTGAATATTTTTATTTTTATTTTTATTCTAGATTTTCTGCTG

Reverse complement sequence

CAGCAGAAAATCTAGAATAAAAATAAAAATAAAAATATTCAACAAGAATATAGAAAATACAGTCATATGAAAATGAGGTACTTTTTACAAAATCATAAAA[A/G]
AAATTGATCTAAAAAACATACTGAGATCGATTAAAAAAAAACATACTGAGATCATGAGATCACGAGATCACGAGCTCATGATGAGCTTTATGATGTAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.20% 2.10% 5.56% 62.19% NA
All Indica  2759 12.30% 2.50% 4.89% 80.25% NA
All Japonica  1512 68.80% 1.20% 3.17% 26.85% NA
Aus  269 5.60% 1.90% 16.73% 75.84% NA
Indica I  595 7.40% 4.90% 5.38% 82.35% NA
Indica II  465 40.60% 2.40% 2.15% 54.84% NA
Indica III  913 2.20% 0.20% 6.02% 91.57% NA
Indica Intermediate  786 11.10% 3.60% 4.83% 80.53% NA
Temperate Japonica  767 94.30% 0.80% 0.26% 4.69% NA
Tropical Japonica  504 27.20% 2.20% 8.73% 61.90% NA
Japonica Intermediate  241 74.70% 0.40% 0.83% 24.07% NA
VI/Aromatic  96 8.30% 0.00% 28.12% 63.54% NA
Intermediate  90 26.70% 4.40% 8.89% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804997889 T -> C LOC_Os08g08640.1 upstream_gene_variant ; 1530.0bp to feature; MODIFIER silent_mutation Average:9.742; most accessible tissue: Callus, score: 18.883 N N N N
vg0804997889 T -> C LOC_Os08g08650.1 downstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:9.742; most accessible tissue: Callus, score: 18.883 N N N N
vg0804997889 T -> C LOC_Os08g08650.2 downstream_gene_variant ; 1825.0bp to feature; MODIFIER silent_mutation Average:9.742; most accessible tissue: Callus, score: 18.883 N N N N
vg0804997889 T -> C LOC_Os08g08640-LOC_Os08g08650 intergenic_region ; MODIFIER silent_mutation Average:9.742; most accessible tissue: Callus, score: 18.883 N N N N
vg0804997889 T -> DEL N N silent_mutation Average:9.742; most accessible tissue: Callus, score: 18.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804997889 NA 4.14E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 1.71E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 1.45E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 7.46E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 3.00E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 2.37E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 3.22E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 1.71E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 9.49E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 2.86E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 5.54E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 3.96E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 3.65E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 2.45E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 6.24E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 1.32E-08 mr1851 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 1.17E-06 4.62E-14 mr1864 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 2.13E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 2.86E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 5.55E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 4.29E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 8.95E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 1.53E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 5.88E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 4.49E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889 NA 6.89E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251