Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804997889:

Variant ID: vg0804997889 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4997889
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTACATCATAAAGCTCATCATGAGCTCGTGATCTCGTGATCTCATGATCTCAGTATGTTTTTTTTTAATCGATCTCAGTATGTTTTTTAGATCAATTT[T/C]
TTTTATGATTTTGTAAAAAGTACCTCATTTTCATATGACTGTATTTTCTATATTCTTGTTGAATATTTTTATTTTTATTTTTATTCTAGATTTTCTGCTG

Reverse complement sequence

CAGCAGAAAATCTAGAATAAAAATAAAAATAAAAATATTCAACAAGAATATAGAAAATACAGTCATATGAAAATGAGGTACTTTTTACAAAATCATAAAA[A/G]
AAATTGATCTAAAAAACATACTGAGATCGATTAAAAAAAAACATACTGAGATCATGAGATCACGAGATCACGAGCTCATGATGAGCTTTATGATGTAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.20%	2.10%	5.56%	62.19%	NA
All Indica	2759	12.30%	2.50%	4.89%	80.25%	NA
All Japonica	1512	68.80%	1.20%	3.17%	26.85%	NA
Aus	269	5.60%	1.90%	16.73%	75.84%	NA
Indica I	595	7.40%	4.90%	5.38%	82.35%	NA
Indica II	465	40.60%	2.40%	2.15%	54.84%	NA
Indica III	913	2.20%	0.20%	6.02%	91.57%	NA
Indica Intermediate	786	11.10%	3.60%	4.83%	80.53%	NA
Temperate Japonica	767	94.30%	0.80%	0.26%	4.69%	NA
Tropical Japonica	504	27.20%	2.20%	8.73%	61.90%	NA
Japonica Intermediate	241	74.70%	0.40%	0.83%	24.07%	NA
VI/Aromatic	96	8.30%	0.00%	28.12%	63.54%	NA
Intermediate	90	26.70%	4.40%	8.89%	60.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804997889	T -> C	LOC_Os08g08640.1	upstream_gene_variant ; 1530.0bp to feature; MODIFIER	silent_mutation	Average:9.742; most accessible tissue: Callus, score: 18.883	N	N	N	N
vg0804997889	T -> C	LOC_Os08g08650.1	downstream_gene_variant ; 1446.0bp to feature; MODIFIER	silent_mutation	Average:9.742; most accessible tissue: Callus, score: 18.883	N	N	N	N
vg0804997889	T -> C	LOC_Os08g08650.2	downstream_gene_variant ; 1825.0bp to feature; MODIFIER	silent_mutation	Average:9.742; most accessible tissue: Callus, score: 18.883	N	N	N	N
vg0804997889	T -> C	LOC_Os08g08640-LOC_Os08g08650	intergenic_region ; MODIFIER	silent_mutation	Average:9.742; most accessible tissue: Callus, score: 18.883	N	N	N	N
vg0804997889	T -> DEL	N	N	silent_mutation	Average:9.742; most accessible tissue: Callus, score: 18.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804997889	NA	4.14E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	1.71E-10	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	1.45E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	7.46E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	3.00E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	2.37E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	3.22E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	1.71E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	9.49E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	2.86E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	5.54E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	3.96E-07	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	3.65E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	2.45E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	6.24E-07	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	1.32E-08	mr1851	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	1.17E-06	4.62E-14	mr1864	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	2.13E-10	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	2.86E-07	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	5.55E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	4.29E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	8.95E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	1.53E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	5.88E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	4.49E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804997889	NA	6.89E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251