\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804975611:

Variant ID: vg0804975611 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4975611
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTCAGGCGGTTTCCAAGTAGAACTCGGAGACATCGGACCCTACACGATACATTGACGACCCAGTCCTGTCCGAGTAGGACTCTTATTCTCTGCAAACT[T/C]
CGTAAAGGATTTCCTTAGTGTATGTAGAGAATGTCCATATATGCGCGGGCATGCCATATCGATATGTAACATATATCGAAGGGTAAAGGGTATACCTAAC

Reverse complement sequence

GTTAGGTATACCCTTTACCCTTCGATATATGTTACATATCGATATGGCATGCCCGCGCATATATGGACATTCTCTACATACACTAAGGAAATCCTTTACG[A/G]
AGTTTGCAGAGAATAAGAGTCCTACTCGGACAGGACTGGGTCGTCAATGTATCGTGTAGGGTCCGATGTCTCCGAGTTCTACTTGGAAACCGCCTGACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 9.50% 3.43% 55.76% NA
All Indica  2759 13.60% 9.50% 5.22% 71.69% NA
All Japonica  1512 69.90% 0.10% 0.66% 29.30% NA
Aus  269 4.50% 63.20% 1.86% 30.48% NA
Indica I  595 10.40% 1.50% 1.85% 86.22% NA
Indica II  465 41.30% 10.30% 5.81% 42.58% NA
Indica III  913 2.10% 11.00% 7.12% 79.85% NA
Indica Intermediate  786 13.10% 13.20% 5.22% 68.45% NA
Temperate Japonica  767 95.00% 0.00% 0.13% 4.82% NA
Tropical Japonica  504 28.60% 0.40% 1.19% 69.84% NA
Japonica Intermediate  241 76.30% 0.00% 1.24% 22.41% NA
VI/Aromatic  96 9.40% 2.10% 1.04% 87.50% NA
Intermediate  90 28.90% 15.60% 2.22% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804975611 T -> C LOC_Os08g08592.1 upstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> C LOC_Os08g08600.1 upstream_gene_variant ; 562.0bp to feature; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> C LOC_Os08g08592.2 upstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> C LOC_Os08g08592.3 upstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> C LOC_Os08g08610.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> C LOC_Os08g08592-LOC_Os08g08600 intergenic_region ; MODIFIER silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975611 T -> DEL N N silent_mutation Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804975611 7.87E-06 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251