\
| Variant ID: vg0804975535 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4975535 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.02, others allele: 0.00, population size: 49. )
TTCGTAGGCTGTGGTGGTTGTGTTGGCTATGAGATTCGATGCCCTCGGTCCTCCCAGGGGGTTCCTTTTATATCGCAGGTCAGGCGGTTTCCAAGTAGAA[C/T]
TCGGAGACATCGGACCCTACACGATACATTGACGACCCAGTCCTGTCCGAGTAGGACTCTTATTCTCTGCAAACTTCGTAAAGGATTTCCTTAGTGTATG
CATACACTAAGGAAATCCTTTACGAAGTTTGCAGAGAATAAGAGTCCTACTCGGACAGGACTGGGTCGTCAATGTATCGTGTAGGGTCCGATGTCTCCGA[G/A]
TTCTACTTGGAAACCGCCTGACCTGCGATATAAAAGGAACCCCCTGGGAGGACCGAGGGCATCGAATCTCATAGCCAACACAACCACCACAGCCTACGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 2.80% | 3.89% | 52.58% | NA |
| All Indica | 2759 | 21.20% | 4.60% | 6.13% | 68.14% | NA |
| All Japonica | 1512 | 72.80% | 0.10% | 0.40% | 26.79% | NA |
| Aus | 269 | 69.50% | 0.00% | 0.74% | 29.74% | NA |
| Indica I | 595 | 12.10% | 0.00% | 3.03% | 84.87% | NA |
| Indica II | 465 | 34.00% | 22.80% | 4.09% | 39.14% | NA |
| Indica III | 913 | 15.60% | 0.10% | 9.64% | 74.70% | NA |
| Indica Intermediate | 786 | 27.00% | 2.40% | 5.60% | 65.01% | NA |
| Temperate Japonica | 767 | 95.30% | 0.00% | 0.13% | 4.56% | NA |
| Tropical Japonica | 504 | 32.70% | 0.20% | 0.79% | 66.27% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.00% | 0.41% | 14.94% | NA |
| VI/Aromatic | 96 | 16.70% | 2.10% | 3.12% | 78.12% | NA |
| Intermediate | 90 | 43.30% | 2.20% | 4.44% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804975535 | C -> T | LOC_Os08g08592.1 | upstream_gene_variant ; 1681.0bp to feature; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> T | LOC_Os08g08600.1 | upstream_gene_variant ; 638.0bp to feature; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> T | LOC_Os08g08592.2 | upstream_gene_variant ; 1681.0bp to feature; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> T | LOC_Os08g08592.3 | upstream_gene_variant ; 1681.0bp to feature; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> T | LOC_Os08g08610.1 | downstream_gene_variant ; 4597.0bp to feature; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> T | LOC_Os08g08592-LOC_Os08g08600 | intergenic_region ; MODIFIER | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0804975535 | C -> DEL | N | N | silent_mutation | Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804975535 | NA | 4.45E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 3.39E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 6.13E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | 2.57E-06 | 4.47E-08 | mr1243 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 2.56E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 3.35E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 1.54E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 3.12E-07 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 3.77E-08 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804975535 | NA | 1.69E-07 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |