\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804975535:

Variant ID: vg0804975535 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4975535
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTAGGCTGTGGTGGTTGTGTTGGCTATGAGATTCGATGCCCTCGGTCCTCCCAGGGGGTTCCTTTTATATCGCAGGTCAGGCGGTTTCCAAGTAGAA[C/T]
TCGGAGACATCGGACCCTACACGATACATTGACGACCCAGTCCTGTCCGAGTAGGACTCTTATTCTCTGCAAACTTCGTAAAGGATTTCCTTAGTGTATG

Reverse complement sequence

CATACACTAAGGAAATCCTTTACGAAGTTTGCAGAGAATAAGAGTCCTACTCGGACAGGACTGGGTCGTCAATGTATCGTGTAGGGTCCGATGTCTCCGA[G/A]
TTCTACTTGGAAACCGCCTGACCTGCGATATAAAAGGAACCCCCTGGGAGGACCGAGGGCATCGAATCTCATAGCCAACACAACCACCACAGCCTACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 2.80% 3.89% 52.58% NA
All Indica  2759 21.20% 4.60% 6.13% 68.14% NA
All Japonica  1512 72.80% 0.10% 0.40% 26.79% NA
Aus  269 69.50% 0.00% 0.74% 29.74% NA
Indica I  595 12.10% 0.00% 3.03% 84.87% NA
Indica II  465 34.00% 22.80% 4.09% 39.14% NA
Indica III  913 15.60% 0.10% 9.64% 74.70% NA
Indica Intermediate  786 27.00% 2.40% 5.60% 65.01% NA
Temperate Japonica  767 95.30% 0.00% 0.13% 4.56% NA
Tropical Japonica  504 32.70% 0.20% 0.79% 66.27% NA
Japonica Intermediate  241 84.60% 0.00% 0.41% 14.94% NA
VI/Aromatic  96 16.70% 2.10% 3.12% 78.12% NA
Intermediate  90 43.30% 2.20% 4.44% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804975535 C -> T LOC_Os08g08592.1 upstream_gene_variant ; 1681.0bp to feature; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> T LOC_Os08g08600.1 upstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> T LOC_Os08g08592.2 upstream_gene_variant ; 1681.0bp to feature; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> T LOC_Os08g08592.3 upstream_gene_variant ; 1681.0bp to feature; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> T LOC_Os08g08610.1 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> T LOC_Os08g08592-LOC_Os08g08600 intergenic_region ; MODIFIER silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N
vg0804975535 C -> DEL N N silent_mutation Average:39.158; most accessible tissue: Minghui63 flower, score: 71.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804975535 NA 4.45E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 3.39E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 6.13E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 2.57E-06 4.47E-08 mr1243 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 2.56E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 3.35E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 1.54E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 3.12E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 3.77E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804975535 NA 1.69E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251