\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804941325:

Variant ID: vg0804941325 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4941325
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.27, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAAGCGTTTTTACAAAGACCATAACACAAGACGGAGAAAAATTACTCCTCAAAAAGAGGGAGAACACTCTCCCCGAGATCCGACACGCTCTCCATCAC[A/G]
CTCTCCCGCGTGGCATTAGCTGCCCCTTTCGCCAAGATGTCCTTGAGGTCAGCGTCGGGAAAAGCGAGCTTCACTCACGCAAGGACGTGACACGCCCCCA

Reverse complement sequence

TGGGGGCGTGTCACGTCCTTGCGTGAGTGAAGCTCGCTTTTCCCGACGCTGACCTCAAGGACATCTTGGCGAAAGGGGCAGCTAATGCCACGCGGGAGAG[T/C]
GTGATGGAGAGCGTGTCGGATCTCGGGGAGAGTGTTCTCCCTCTTTTTGAGGAGTAATTTTTCTCCGTCTTGTGTTATGGTCTTTGTAAAAACGCTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 26.70% 3.43% 31.15% NA
All Indica  2759 56.40% 6.90% 5.04% 31.71% NA
All Japonica  1512 5.00% 68.40% 0.99% 25.60% NA
Aus  269 46.10% 4.10% 0.37% 49.44% NA
Indica I  595 89.70% 6.40% 0.67% 3.19% NA
Indica II  465 26.50% 15.70% 2.37% 55.48% NA
Indica III  913 49.40% 1.90% 8.98% 39.76% NA
Indica Intermediate  786 57.00% 7.80% 5.34% 29.90% NA
Temperate Japonica  767 1.70% 92.80% 1.04% 4.43% NA
Tropical Japonica  504 11.70% 27.40% 0.99% 59.92% NA
Japonica Intermediate  241 1.70% 76.30% 0.83% 21.16% NA
VI/Aromatic  96 37.50% 7.30% 1.04% 54.17% NA
Intermediate  90 41.10% 24.40% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804941325 A -> G LOC_Os08g08550.1 upstream_gene_variant ; 3556.0bp to feature; MODIFIER silent_mutation Average:30.026; most accessible tissue: Callus, score: 73.986 N N N N
vg0804941325 A -> G LOC_Os08g08560.1 intron_variant ; MODIFIER silent_mutation Average:30.026; most accessible tissue: Callus, score: 73.986 N N N N
vg0804941325 A -> DEL N N silent_mutation Average:30.026; most accessible tissue: Callus, score: 73.986 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804941325 NA 4.87E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 2.08E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 4.46E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 7.39E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 1.56E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 8.99E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 3.44E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 1.53E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 1.40E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 8.22E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 NA 1.77E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804941325 3.34E-07 NA mr1929_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251