\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804905723:

Variant ID: vg0804905723 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4905723
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCTATGAAAAACTTCACTGTTGGGCACCTTTTAAAGTGCATTGTACCAACTCCTAAAAAGTTGAATAACTGTGGTATAAAAGGATTTTAAGGTATTG[G/T]
GCACTTGATCACGCGCACTTTGGCCGAAGCAAAAAGTACCTAAGTCCCTAAAAGAACGTGACAGGCCACACCTAAAAATATGGGCTGCAAACATATTAGG

Reverse complement sequence

CCTAATATGTTTGCAGCCCATATTTTTAGGTGTGGCCTGTCACGTTCTTTTAGGGACTTAGGTACTTTTTGCTTCGGCCAAAGTGCGCGTGATCAAGTGC[C/A]
CAATACCTTAAAATCCTTTTATACCACAGTTATTCAACTTTTTAGGAGTTGGTACAATGCACTTTAAAAGGTGCCCAACAGTGAAGTTTTTCATAGCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 4.20% 2.56% 13.52% NA
All Indica  2759 90.10% 0.30% 0.43% 9.24% NA
All Japonica  1512 56.70% 12.00% 6.94% 24.34% NA
Aus  269 97.40% 0.40% 0.37% 1.86% NA
Indica I  595 94.60% 0.00% 0.00% 5.38% NA
Indica II  465 68.00% 0.40% 1.29% 30.32% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 0.30% 0.76% 10.43% NA
Temperate Japonica  767 86.40% 1.70% 0.65% 11.21% NA
Tropical Japonica  504 19.00% 19.60% 19.44% 41.87% NA
Japonica Intermediate  241 41.10% 28.60% 0.83% 29.46% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 78.90% 6.70% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804905723 G -> T LOC_Os08g08510.1 upstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:39.183; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0804905723 G -> T LOC_Os08g08520.1 downstream_gene_variant ; 3262.0bp to feature; MODIFIER silent_mutation Average:39.183; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0804905723 G -> T LOC_Os08g08500-LOC_Os08g08510 intergenic_region ; MODIFIER silent_mutation Average:39.183; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0804905723 G -> DEL N N silent_mutation Average:39.183; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804905723 6.20E-08 6.20E-08 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 5.46E-06 5.45E-06 mr1184_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.37E-07 1.37E-07 mr1192_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 7.85E-06 mr1267_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.04E-06 1.04E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 8.60E-08 8.60E-08 mr1284_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.73E-07 1.73E-07 mr1286_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 9.81E-06 9.81E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 4.49E-09 4.49E-09 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 2.13E-06 2.13E-06 mr1369_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.21E-08 1.21E-08 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 3.38E-07 3.38E-07 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 8.91E-08 4.23E-09 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 6.06E-07 6.06E-07 mr1412_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 5.55E-06 4.55E-07 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 2.28E-06 2.28E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.61E-06 1.61E-06 mr1485_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 1.99E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 8.39E-06 8.39E-06 mr1652_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.07E-07 1.07E-07 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.27E-06 1.10E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 5.77E-07 5.77E-07 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 3.61E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 9.60E-07 9.59E-07 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.88E-07 1.88E-07 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 6.42E-06 1.53E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 7.65E-07 7.65E-07 mr1753_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 3.76E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 8.75E-08 8.75E-08 mr1760_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 1.77E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 1.33E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 7.14E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 3.84E-06 3.84E-06 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.25E-06 1.25E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 6.81E-07 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 8.42E-07 8.42E-07 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 1.42E-07 1.42E-07 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 NA 3.15E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 4.48E-06 NA mr1864_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804905723 2.59E-06 2.59E-06 mr1970_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251