\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804904491:

Variant ID: vg0804904491 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4904491
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGCACTTATAAAAATTAAGATAATCAAGGTATAATACCTGTCGAAACATGAATTCGGCAATAATAAAAGGGATAGCGCACGAGACCTAAAAGTGGATG[G/A]
ATGCGGAGACAAAAGATTTAGACAGGTTCAGGCCCTCTCAGTGAGAGGTAATACCCTACTCCTGTTTAGGGATTTGAATCCGCCGGGTGTGTATTGATCT

Reverse complement sequence

AGATCAATACACACCCGGCGGATTCAAATCCCTAAACAGGAGTAGGGTATTACCTCTCACTGAGAGGGCCTGAACCTGTCTAAATCTTTTGTCTCCGCAT[C/T]
CATCCACTTTTAGGTCTCGTGCGCTATCCCTTTTATTATTGCCGAATTCATGTTTCGACAGGTATTATACCTTGATTATCTTAATTTTTATAAGTGCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 3.60% 0.97% 15.32% NA
All Indica  2759 90.30% 0.30% 0.25% 9.24% NA
All Japonica  1512 57.40% 10.30% 2.25% 30.03% NA
Aus  269 97.40% 0.40% 0.74% 1.49% NA
Indica I  595 94.80% 0.00% 0.17% 5.04% NA
Indica II  465 68.40% 0.20% 0.86% 30.54% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 0.40% 0.25% 10.56% NA
Temperate Japonica  767 87.10% 1.60% 0.65% 10.69% NA
Tropical Japonica  504 19.00% 15.50% 4.56% 60.91% NA
Japonica Intermediate  241 43.20% 27.40% 2.49% 26.97% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 80.00% 4.40% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804904491 G -> A LOC_Os08g08500.1 upstream_gene_variant ; 4232.0bp to feature; MODIFIER silent_mutation Average:72.179; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0804904491 G -> A LOC_Os08g08510.1 upstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:72.179; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0804904491 G -> A LOC_Os08g08520.1 downstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:72.179; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0804904491 G -> A LOC_Os08g08500-LOC_Os08g08510 intergenic_region ; MODIFIER silent_mutation Average:72.179; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0804904491 G -> DEL N N silent_mutation Average:72.179; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804904491 9.31E-06 9.31E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 5.03E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 8.46E-06 8.46E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 7.33E-06 7.32E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 5.76E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 4.14E-06 4.13E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 7.66E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 1.21E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 4.48E-06 mr1646_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 4.99E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 6.99E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 2.50E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804904491 NA 5.07E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251