\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804887405:

Variant ID: vg0804887405 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4887405
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACGACGGCGGCGACTAGGGCTACGCGGAGGCGGCGCTAGACGCGACGGCAGGCTAAGGCAAAGGAGGCGACGGGTAGAGGAGAGCTCGGGGGTCCTT[A/T]
TAAAGGGGCTAGCGAGCGGCGACGGAGGCCCACGGCGACCGGCGGCGAGAAGGAAAGGTCGGGGATTCGGAGGAAAGAGAGGAATCCGATTCGACCTCGA

Reverse complement sequence

TCGAGGTCGAATCGGATTCCTCTCTTTCCTCCGAATCCCCGACCTTTCCTTCTCGCCGCCGGTCGCCGTGGGCCTCCGTCGCCGCTCGCTAGCCCCTTTA[T/A]
AAGGACCCCCGAGCTCTCCTCTACCCGTCGCCTCCTTTGCCTTAGCCTGCCGTCGCGTCTAGCGCCGCCTCCGCGTAGCCCTAGTCGCCGCCGTCGTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 1.70% 26.09% 15.40% NA
All Indica  2759 46.20% 2.60% 34.51% 16.67% NA
All Japonica  1512 82.90% 0.20% 3.84% 13.03% NA
Aus  269 34.60% 1.50% 52.42% 11.52% NA
Indica I  595 18.80% 2.20% 60.00% 18.99% NA
Indica II  465 25.40% 1.50% 37.20% 35.91% NA
Indica III  913 77.40% 3.50% 14.13% 4.93% NA
Indica Intermediate  786 43.00% 2.50% 37.28% 17.18% NA
Temperate Japonica  767 88.80% 0.10% 2.48% 8.60% NA
Tropical Japonica  504 79.20% 0.40% 5.16% 15.28% NA
Japonica Intermediate  241 72.20% 0.00% 5.39% 22.41% NA
VI/Aromatic  96 13.50% 2.10% 60.42% 23.96% NA
Intermediate  90 53.30% 1.10% 26.67% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804887405 A -> T LOC_Os08g08460-LOC_Os08g08500 intergenic_region ; MODIFIER silent_mutation Average:61.432; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg0804887405 A -> DEL N N silent_mutation Average:61.432; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804887405 1.31E-06 3.40E-08 mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 1.31E-07 3.32E-09 mr1439_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 NA 8.89E-06 mr1445_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 6.18E-06 8.10E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 1.37E-06 5.42E-08 mr1449_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 6.59E-06 3.35E-06 mr1452_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 4.29E-06 7.17E-08 mr1452_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 NA 1.89E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 6.71E-06 7.01E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 1.22E-06 6.24E-08 mr1712_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 NA 9.45E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804887405 NA 1.90E-06 mr1761_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251