\
| Variant ID: vg0804879390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4879390 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.32, A: 0.02, others allele: 0.00, population size: 41. )
AGAACTAAATCTGCTCGATCGGCTGTAGATATCAATGATATATAATCCTTATATCGACATATACTTGAATCAAGTGATTGGGATAGATCGGTCACCTTGC[T/C,A]
GAGACAGTATAAATCACTTAGATTGAAATATATATTAATAATGAGATTATACATATTCATAGCATAGCCGATCAAATAGATCTAGCATGTATCGGCTAAT
ATTAGCCGATACATGCTAGATCTATTTGATCGGCTATGCTATGAATATGTATAATCTCATTATTAATATATATTTCAATCTAAGTGATTTATACTGTCTC[A/G,T]
GCAAGGTGACCGATCTATCCCAATCACTTGATTCAAGTATATGTCGATATAAGGATTATATATCATTGATATCTACAGCCGATCGAGCAGATTTAGTTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 3.30% | 19.64% | 24.65% | A: 0.08% |
| All Indica | 2759 | 40.70% | 4.80% | 18.74% | 35.67% | A: 0.07% |
| All Japonica | 1512 | 83.10% | 0.10% | 10.78% | 6.02% | NA |
| Aus | 269 | 16.00% | 6.70% | 73.61% | 2.97% | A: 0.74% |
| Indica I | 595 | 30.90% | 0.00% | 25.55% | 43.36% | A: 0.17% |
| Indica II | 465 | 30.50% | 24.50% | 19.57% | 25.38% | NA |
| Indica III | 913 | 51.00% | 0.10% | 13.03% | 35.71% | A: 0.11% |
| Indica Intermediate | 786 | 42.20% | 2.20% | 19.72% | 35.88% | NA |
| Temperate Japonica | 767 | 90.40% | 0.00% | 5.48% | 4.17% | NA |
| Tropical Japonica | 504 | 77.40% | 0.00% | 12.70% | 9.92% | NA |
| Japonica Intermediate | 241 | 72.20% | 0.40% | 23.65% | 3.73% | NA |
| VI/Aromatic | 96 | 10.40% | 2.10% | 28.12% | 59.38% | NA |
| Intermediate | 90 | 42.20% | 4.40% | 25.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804879390 | T -> C | LOC_Os08g08460.1 | upstream_gene_variant ; 394.0bp to feature; MODIFIER | silent_mutation | Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg0804879390 | T -> C | LOC_Os08g08460-LOC_Os08g08500 | intergenic_region ; MODIFIER | silent_mutation | Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg0804879390 | T -> A | LOC_Os08g08460.1 | upstream_gene_variant ; 394.0bp to feature; MODIFIER | silent_mutation | Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg0804879390 | T -> A | LOC_Os08g08460-LOC_Os08g08500 | intergenic_region ; MODIFIER | silent_mutation | Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg0804879390 | T -> DEL | N | N | silent_mutation | Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804879390 | NA | 1.18E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 1.77E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 1.26E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 5.14E-06 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 4.68E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 3.33E-07 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 8.90E-08 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 3.43E-08 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 5.53E-09 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 1.18E-07 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | NA | 3.65E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804879390 | 9.10E-07 | NA | mr1642_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |