\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804879390:

Variant ID: vg0804879390 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4879390
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.32, A: 0.02, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACTAAATCTGCTCGATCGGCTGTAGATATCAATGATATATAATCCTTATATCGACATATACTTGAATCAAGTGATTGGGATAGATCGGTCACCTTGC[T/C,A]
GAGACAGTATAAATCACTTAGATTGAAATATATATTAATAATGAGATTATACATATTCATAGCATAGCCGATCAAATAGATCTAGCATGTATCGGCTAAT

Reverse complement sequence

ATTAGCCGATACATGCTAGATCTATTTGATCGGCTATGCTATGAATATGTATAATCTCATTATTAATATATATTTCAATCTAAGTGATTTATACTGTCTC[A/G,T]
GCAAGGTGACCGATCTATCCCAATCACTTGATTCAAGTATATGTCGATATAAGGATTATATATCATTGATATCTACAGCCGATCGAGCAGATTTAGTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 3.30% 19.64% 24.65% A: 0.08%
All Indica  2759 40.70% 4.80% 18.74% 35.67% A: 0.07%
All Japonica  1512 83.10% 0.10% 10.78% 6.02% NA
Aus  269 16.00% 6.70% 73.61% 2.97% A: 0.74%
Indica I  595 30.90% 0.00% 25.55% 43.36% A: 0.17%
Indica II  465 30.50% 24.50% 19.57% 25.38% NA
Indica III  913 51.00% 0.10% 13.03% 35.71% A: 0.11%
Indica Intermediate  786 42.20% 2.20% 19.72% 35.88% NA
Temperate Japonica  767 90.40% 0.00% 5.48% 4.17% NA
Tropical Japonica  504 77.40% 0.00% 12.70% 9.92% NA
Japonica Intermediate  241 72.20% 0.40% 23.65% 3.73% NA
VI/Aromatic  96 10.40% 2.10% 28.12% 59.38% NA
Intermediate  90 42.20% 4.40% 25.56% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804879390 T -> C LOC_Os08g08460.1 upstream_gene_variant ; 394.0bp to feature; MODIFIER silent_mutation Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0804879390 T -> C LOC_Os08g08460-LOC_Os08g08500 intergenic_region ; MODIFIER silent_mutation Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0804879390 T -> A LOC_Os08g08460.1 upstream_gene_variant ; 394.0bp to feature; MODIFIER silent_mutation Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0804879390 T -> A LOC_Os08g08460-LOC_Os08g08500 intergenic_region ; MODIFIER silent_mutation Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0804879390 T -> DEL N N silent_mutation Average:16.515; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804879390 NA 1.18E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 1.77E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 1.26E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 5.14E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 4.68E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 3.33E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 8.90E-08 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 3.43E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 5.53E-09 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 1.18E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 NA 3.65E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804879390 9.10E-07 NA mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251