\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804876696:

Variant ID: vg0804876696 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4876696
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGACCTTCATTGGTTTCTTCGAATCATCAAACCTGATTTTTCCTCTCTCAATAGCCGTTTGGATTTGCTGCCTGAAGTCCTTGCAGTCATTAGTCG[C/T]
ATGAGACCCAGAATTATGCCACTTACAATACCTCTTCTTGCCCAACTCTTCAGCCGATGGAATTATATGTCCGGCAGGAAGTTGAATCTGTTTTTTTTGA

Reverse complement sequence

TCAAAAAAAACAGATTCAACTTCCTGCCGGACATATAATTCCATCGGCTGAAGAGTTGGGCAAGAAGAGGTATTGTAAGTGGCATAATTCTGGGTCTCAT[G/A]
CGACTAATGACTGCAAGGACTTCAGGCAGCAAATCCAAACGGCTATTGAGAGAGGAAAAATCAGGTTTGATGATTCGAAGAAACCAATGAAGGTCGATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 19.30% 23.80% 23.80% NA
All Indica  2759 9.40% 31.10% 25.59% 33.93% NA
All Japonica  1512 83.10% 1.90% 10.19% 4.89% NA
Aus  269 4.10% 3.00% 82.90% 10.04% NA
Indica I  595 7.90% 8.70% 17.31% 66.05% NA
Indica II  465 30.80% 31.60% 24.52% 13.12% NA
Indica III  913 1.20% 45.10% 29.13% 24.53% NA
Indica Intermediate  786 7.30% 31.60% 28.37% 32.82% NA
Temperate Japonica  767 89.40% 0.40% 4.43% 5.74% NA
Tropical Japonica  504 78.40% 4.00% 12.10% 5.56% NA
Japonica Intermediate  241 72.60% 2.10% 24.48% 0.83% NA
VI/Aromatic  96 6.20% 1.00% 13.54% 79.17% NA
Intermediate  90 38.90% 15.60% 32.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804876696 C -> T LOC_Os08g08460.1 missense_variant ; p.Ala716Thr; MODERATE nonsynonymous_codon ; A716T Average:27.451; most accessible tissue: Minghui63 flag leaf, score: 64.284 benign -0.044 TOLERATED 0.27
vg0804876696 C -> DEL LOC_Os08g08460.1 N frameshift_variant Average:27.451; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804876696 NA 3.42E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804876696 NA 8.28E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804876696 NA 4.70E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804876696 3.34E-07 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804876696 9.97E-07 NA mr1334_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804876696 NA 1.20E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251