\
| Variant ID: vg0804876696 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4876696 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCATCGACCTTCATTGGTTTCTTCGAATCATCAAACCTGATTTTTCCTCTCTCAATAGCCGTTTGGATTTGCTGCCTGAAGTCCTTGCAGTCATTAGTCG[C/T]
ATGAGACCCAGAATTATGCCACTTACAATACCTCTTCTTGCCCAACTCTTCAGCCGATGGAATTATATGTCCGGCAGGAAGTTGAATCTGTTTTTTTTGA
TCAAAAAAAACAGATTCAACTTCCTGCCGGACATATAATTCCATCGGCTGAAGAGTTGGGCAAGAAGAGGTATTGTAAGTGGCATAATTCTGGGTCTCAT[G/A]
CGACTAATGACTGCAAGGACTTCAGGCAGCAAATCCAAACGGCTATTGAGAGAGGAAAAATCAGGTTTGATGATTCGAAGAAACCAATGAAGGTCGATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.10% | 19.30% | 23.80% | 23.80% | NA |
| All Indica | 2759 | 9.40% | 31.10% | 25.59% | 33.93% | NA |
| All Japonica | 1512 | 83.10% | 1.90% | 10.19% | 4.89% | NA |
| Aus | 269 | 4.10% | 3.00% | 82.90% | 10.04% | NA |
| Indica I | 595 | 7.90% | 8.70% | 17.31% | 66.05% | NA |
| Indica II | 465 | 30.80% | 31.60% | 24.52% | 13.12% | NA |
| Indica III | 913 | 1.20% | 45.10% | 29.13% | 24.53% | NA |
| Indica Intermediate | 786 | 7.30% | 31.60% | 28.37% | 32.82% | NA |
| Temperate Japonica | 767 | 89.40% | 0.40% | 4.43% | 5.74% | NA |
| Tropical Japonica | 504 | 78.40% | 4.00% | 12.10% | 5.56% | NA |
| Japonica Intermediate | 241 | 72.60% | 2.10% | 24.48% | 0.83% | NA |
| VI/Aromatic | 96 | 6.20% | 1.00% | 13.54% | 79.17% | NA |
| Intermediate | 90 | 38.90% | 15.60% | 32.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804876696 | C -> T | LOC_Os08g08460.1 | missense_variant ; p.Ala716Thr; MODERATE | nonsynonymous_codon ; A716T | Average:27.451; most accessible tissue: Minghui63 flag leaf, score: 64.284 | benign |
-0.044 |
TOLERATED | 0.27 |
| vg0804876696 | C -> DEL | LOC_Os08g08460.1 | N | frameshift_variant | Average:27.451; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804876696 | NA | 3.42E-08 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804876696 | NA | 8.28E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804876696 | NA | 4.70E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804876696 | 3.34E-07 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804876696 | 9.97E-07 | NA | mr1334_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804876696 | NA | 1.20E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |