| Variant ID: vg0804875587 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4875587 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACTGGCACGATCTCTATCTTGTCGCCTTGCCATTGAATCAAACATTGGTGCATGGTTGAAGGAATACAACAATTAGCATGAATCCAATCTCTTCCAAG[C/A,T]
AACAAGCTATAAGAACCCTTCCCATCGATGACAAAGAATGTTGTAGGGATTATTTTACTGCCGACTGTCAGCTCCACGTTCAAAACCCCTTTGGTTTCTG
CAGAAACCAAAGGGGTTTTGAACGTGGAGCTGACAGTCGGCAGTAAAATAATCCCTACAACATTCTTTGTCATCGATGGGAAGGGTTCTTATAGCTTGTT[G/T,A]
CTTGGAAGAGATTGGATTCATGCTAATTGTTGTATTCCTTCAACCATGCACCAATGTTTGATTCAATGGCAAGGCGACAAGATAGAGATCGTGCCAGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 0.30% | 15.47% | 4.61% | NA |
| All Indica | 2759 | 72.60% | 0.00% | 19.79% | 7.65% | NA |
| All Japonica | 1512 | 89.00% | 0.70% | 9.85% | 0.40% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 50.30% | 0.00% | 29.92% | 19.83% | NA |
| Indica II | 465 | 92.90% | 0.00% | 4.30% | 2.80% | NA |
| Indica III | 913 | 72.60% | 0.00% | 24.42% | 2.96% | NA |
| Indica Intermediate | 786 | 77.40% | 0.00% | 15.90% | 6.74% | NA |
| Temperate Japonica | 767 | 94.30% | 0.00% | 5.08% | 0.65% | NA |
| Tropical Japonica | 504 | 86.70% | 0.80% | 12.30% | 0.20% | NA |
| Japonica Intermediate | 241 | 77.20% | 2.90% | 19.92% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 26.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 10.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804875587 | C -> T | LOC_Os08g08460.1 | synonymous_variant ; p.Leu1085Leu; LOW | N | Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 43.614 | N | N | N | N |
| vg0804875587 | C -> T | LOC_Os08g08450.1 | downstream_gene_variant ; 3847.0bp to feature; MODIFIER | N | Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 43.614 | N | N | N | N |
| vg0804875587 | C -> A | LOC_Os08g08460.1 | missense_variant ; p.Leu1085Phe; MODERATE | nonsynonymous_codon ; L1085F | Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 43.614 | benign |
1.204 |
DELETERIOUS | 0.03 |
| vg0804875587 | C -> DEL | LOC_Os08g08460.1 | N | frameshift_variant | Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 43.614 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804875587 | 8.66E-06 | NA | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875587 | 2.44E-07 | NA | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875587 | 1.19E-07 | NA | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875587 | 1.73E-06 | NA | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |