Search for Variation information by Variation ID:
Detailed information for vg0804873511:
| Variant ID: vg0804873511 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4873511 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 47. )
Flanking Sequence (100 bp) in Reference Genome:
CGAGACACATGCTTCAAAGTCACTAGCCGAAACGTTTTCATCAGTTCTTGGCACTTCTCATTATAAACCATCAACGTATCATTCTTGCACTCATATTCTC[T/C]
TGCCAACTGATTGATAACTAACAAAGAATCTCCCATAATTTCAATAGCATCGGCTTCAACCTCCTTGAGCAATTGCAACCCTTTAAGAATTGCCTCATAC
Reverse complement sequence
GTATGAGGCAATTCTTAAAGGGTTGCAATTGCTCAAGGAGGTTGAAGCCGATGCTATTGAAATTATGGGAGATTCTTTGTTAGTTATCAATCAGTTGGCA[A/G]
GAGAATATGAGTGCAAGAATGATACGTTGATGGTTTATAATGAGAAGTGCCAAGAACTGATGAAAACGTTTCGGCTAGTGACTTTGAAGCATGTGTCTCG
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.90% | 15.90% | 33.73% | 20.50% | NA |
| All Indica | 2759 | 4.60% | 24.90% | 46.39% | 24.03% | NA |
| All Japonica | 1512 | 81.80% | 0.50% | 12.70% | 5.03% | NA |
| Aus | 269 | 3.00% | 13.80% | 30.86% | 52.42% | NA |
| Indica I | 595 | 8.60% | 9.60% | 38.49% | 43.36% | NA |
| Indica II | 465 | 5.40% | 43.70% | 40.22% | 10.75% | NA |
| Indica III | 913 | 0.70% | 28.90% | 54.98% | 15.44% | NA |
| Indica Intermediate | 786 | 5.90% | 20.90% | 46.06% | 27.23% | NA |
| Temperate Japonica | 767 | 89.40% | 0.00% | 7.17% | 3.39% | NA |
| Tropical Japonica | 504 | 75.60% | 1.20% | 13.89% | 9.33% | NA |
| Japonica Intermediate | 241 | 70.50% | 0.40% | 27.80% | 1.24% | NA |
| VI/Aromatic | 96 | 6.20% | 6.20% | 5.21% | 82.29% | NA |
| Intermediate | 90 | 35.60% | 15.60% | 37.78% | 11.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804873511 | T -> C | LOC_Os08g08460.1 | missense_variant ; p.Arg1628Gly; MODERATE | nonsynonymous_codon ; R1628G | Average:20.419; most accessible tissue: Minghui63 flag leaf, score: 41.254 | benign  |
-1.042 |
TOLERATED | 1.00 |
| vg0804873511 | T -> DEL | LOC_Os08g08460.1 | N | frameshift_variant | Average:20.419; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804873511 | NA | 2.77E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804873511 | 3.32E-06 | NA | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804873511 | NA | 3.52E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804873511 | NA | 9.68E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804873511 | 6.69E-06 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804873511 | NA | 3.85E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |