\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804871904:

Variant ID: vg0804871904 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4871904
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTATTGTGATAGAAGCTCAAAAATTTTGCACTGTATTGTGATAGATATATATGCCCACCTAGTTTTACAATGTCAAAAGCATTGATAAAAATATGAAAC[C/A]
ACTAAGGACGATATAACAATATCGGCCATTGTACATCGGCAAACCTCAACCGATTACAATAAAACAACTAAAGGCGATATAACAATATCGGCCATCTCAA

Reverse complement sequence

TTGAGATGGCCGATATTGTTATATCGCCTTTAGTTGTTTTATTGTAATCGGTTGAGGTTTGCCGATGTACAATGGCCGATATTGTTATATCGTCCTTAGT[G/T]
GTTTCATATTTTTATCAATGCTTTTGACATTGTAAAACTAGGTGGGCATATATATCTATCACAATACAGTGCAAAATTTTTGAGCTTCTATCACAATACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 0.10% 11.66% 55.29% NA
All Indica  2759 9.80% 0.00% 12.90% 77.24% NA
All Japonica  1512 81.70% 0.30% 7.54% 10.45% NA
Aus  269 3.30% 0.00% 8.55% 88.10% NA
Indica I  595 8.20% 0.00% 4.87% 86.89% NA
Indica II  465 31.00% 0.00% 12.47% 56.56% NA
Indica III  913 1.30% 0.00% 18.40% 80.28% NA
Indica Intermediate  786 8.40% 0.10% 12.85% 78.63% NA
Temperate Japonica  767 89.00% 0.00% 1.56% 9.39% NA
Tropical Japonica  504 75.60% 0.40% 12.30% 11.71% NA
Japonica Intermediate  241 71.40% 0.80% 16.60% 11.20% NA
VI/Aromatic  96 6.20% 0.00% 50.00% 43.75% NA
Intermediate  90 38.90% 0.00% 11.11% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804871904 C -> A LOC_Os08g08450.1 downstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:29.688; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0804871904 C -> A LOC_Os08g08460.1 downstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:29.688; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0804871904 C -> A LOC_Os08g08450-LOC_Os08g08460 intergenic_region ; MODIFIER silent_mutation Average:29.688; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0804871904 C -> DEL N N silent_mutation Average:29.688; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804871904 NA 3.01E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 5.51E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 4.07E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 3.76E-06 4.21E-10 mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 2.08E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 1.73E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 3.41E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 8.08E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 2.07E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 2.08E-06 NA mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 3.03E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 4.25E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 3.79E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 5.10E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804871904 NA 3.66E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251