Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804869267:

Variant ID: vg0804869267 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4869267
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATACGATTTCAAGACCAAGAGTATAGGCGGTTGGTCAGGCTATGTAGCAGCATACATGGGTAAAGGGCCCGTCACTCCTCGAGAGCATGTAGCCTTTCT[G/A]
CTGATGTGGCTGGAAAAATTCCTCTTTTGTGGATCAAGCTGTGGCCCTACAACCAACTGGCAGTTCGTAGCCGAGGCCTTGGAAGCAAAAAAACAATTTC

Reverse complement sequence

GAAATTGTTTTTTTGCTTCCAAGGCCTCGGCTACGAACTGCCAGTTGGTTGTAGGGCCACAGCTTGATCCACAAAAGAGGAATTTTTCCAGCCACATCAG[C/T]
AGAAAGGCTACATGCTCTCGAGGAGTGACGGGCCCTTTACCCATGTATGCTGCTACATAGCCTGACCAACCGCCTATACTCTTGGTCTTGAAATCGTATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	10.20%	1.84%	0.76%	NA
All Indica	2759	98.30%	0.30%	0.54%	0.80%	NA
All Japonica	1512	64.70%	30.00%	4.30%	0.93%	NA
Aus	269	97.40%	1.90%	0.74%	0.00%	NA
Indica I	595	99.50%	0.00%	0.34%	0.17%	NA
Indica II	465	98.70%	0.60%	0.65%	0.00%	NA
Indica III	913	97.90%	0.20%	0.33%	1.53%	NA
Indica Intermediate	786	97.70%	0.50%	0.89%	0.89%	NA
Temperate Japonica	767	96.10%	2.90%	1.04%	0.00%	NA
Tropical Japonica	504	18.10%	70.60%	9.52%	1.79%	NA
Japonica Intermediate	241	62.70%	31.50%	3.73%	2.07%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	12.20%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804869267	G -> A	LOC_Os08g08450.1	synonymous_variant ; p.Leu207Leu; LOW	synonymous_codon	Average:38.821; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0804869267	G -> DEL	LOC_Os08g08450.1	N	frameshift_variant	Average:38.821; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804869267	NA	6.31E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	5.26E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.43E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	3.82E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	8.88E-07	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	1.26E-06	NA	mr1123_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	4.83E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	3.96E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	3.42E-06	NA	mr1247_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	8.07E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	7.20E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	6.77E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	9.94E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.15E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	5.64E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.53E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.14E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	3.29E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	7.66E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	4.22E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.07E-12	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	1.81E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	6.26E-10	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	5.30E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	8.89E-06	NA	mr1936_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	4.90E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804869267	NA	2.83E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251