\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804865671:

Variant ID: vg0804865671 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4865671
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTAACAACAGAACGGAGCAGAGGATGACCGATCCCCTTCGACACACTCTCTGTGTGTGTGTGCGCGCCCGAGTACCCACCCAATATAATTTTTCCTC[G/A]
TTCTTGCAATCTCGCCTCATCCGTCCAGGCGTCCGGCTCTTATCAGTGCTGAACGCGTCGGATCATGAAACCGGTTGCATCGATATACGTGCTTCCCTTC

Reverse complement sequence

GAAGGGAAGCACGTATATCGATGCAACCGGTTTCATGATCCGACGCGTTCAGCACTGATAAGAGCCGGACGCCTGGACGGATGAGGCGAGATTGCAAGAA[C/T]
GAGGAAAAATTATATTGGGTGGGTACTCGGGCGCGCACACACACACAGAGAGTGTGTCGAAGGGGATCGGTCATCCTCTGCTCCGTTCTGTTGTTAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 19.10% 0.30% 2.52% NA
All Indica  2759 74.20% 25.40% 0.36% 0.07% NA
All Japonica  1512 81.20% 11.60% 0.20% 6.94% NA
Aus  269 96.70% 0.70% 0.00% 2.60% NA
Indica I  595 91.30% 8.60% 0.17% 0.00% NA
Indica II  465 59.10% 40.40% 0.43% 0.00% NA
Indica III  913 71.70% 27.90% 0.22% 0.11% NA
Indica Intermediate  786 73.00% 26.20% 0.64% 0.13% NA
Temperate Japonica  767 89.30% 9.30% 0.13% 1.30% NA
Tropical Japonica  504 75.60% 11.30% 0.20% 12.90% NA
Japonica Intermediate  241 67.20% 19.90% 0.41% 12.45% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 72.20% 22.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804865671 G -> A LOC_Os08g08450.1 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:79.015; most accessible tissue: Callus, score: 92.038 N N N N
vg0804865671 G -> A LOC_Os08g08440-LOC_Os08g08450 intergenic_region ; MODIFIER silent_mutation Average:79.015; most accessible tissue: Callus, score: 92.038 N N N N
vg0804865671 G -> DEL N N silent_mutation Average:79.015; most accessible tissue: Callus, score: 92.038 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804865671 G A -0.12 -0.05 -0.04 0.0 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804865671 NA 2.23E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 1.28E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 1.03E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 2.00E-06 8.90E-07 mr1729 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 2.21E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 1.84E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 3.56E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 1.10E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 8.94E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 2.55E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 2.27E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 4.44E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804865671 NA 1.76E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251