\
| Variant ID: vg0804864010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4864010 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )
ACACCTACAAATTGGATGTCCGATTTTTGTTGTAAAATTCCGGACGTTATTTCAGTACGTGTAAGAAAAATGTTTCACCACTAGTTTAACTCATGTTTCA[G/A]
ATAAATTTAAATGATGAAACACGTGCGGTTGAATCATGGACTGAAATAATTTGTTTTGAAACATGAAACATTAAAGTTCAATTATTGAAATATTAACAAA
TTTGTTAATATTTCAATAATTGAACTTTAATGTTTCATGTTTCAAAACAAATTATTTCAGTCCATGATTCAACCGCACGTGTTTCATCATTTAAATTTAT[C/T]
TGAAACATGAGTTAAACTAGTGGTGAAACATTTTTCTTACACGTACTGAAATAACGTCCGGAATTTTACAACAAAAATCGGACATCCAATTTGTAGGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.90% | 19.10% | 0.63% | 2.33% | NA |
| All Indica | 2759 | 73.60% | 25.40% | 0.87% | 0.07% | NA |
| All Japonica | 1512 | 81.50% | 11.80% | 0.26% | 6.42% | NA |
| Aus | 269 | 96.70% | 0.70% | 0.37% | 2.23% | NA |
| Indica I | 595 | 91.30% | 8.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 58.90% | 40.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 70.30% | 27.80% | 1.75% | 0.11% | NA |
| Indica Intermediate | 786 | 72.80% | 26.50% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 89.20% | 9.50% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 76.40% | 11.30% | 0.40% | 11.90% | NA |
| Japonica Intermediate | 241 | 68.00% | 19.90% | 0.83% | 11.20% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 22.20% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804864010 | G -> A | LOC_Os08g08440.1 | upstream_gene_variant ; 4906.0bp to feature; MODIFIER | silent_mutation | Average:49.366; most accessible tissue: Callus, score: 87.585 | N | N | N | N |
| vg0804864010 | G -> A | LOC_Os08g08450.1 | upstream_gene_variant ; 4539.0bp to feature; MODIFIER | silent_mutation | Average:49.366; most accessible tissue: Callus, score: 87.585 | N | N | N | N |
| vg0804864010 | G -> A | LOC_Os08g08440-LOC_Os08g08450 | intergenic_region ; MODIFIER | silent_mutation | Average:49.366; most accessible tissue: Callus, score: 87.585 | N | N | N | N |
| vg0804864010 | G -> DEL | N | N | silent_mutation | Average:49.366; most accessible tissue: Callus, score: 87.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804864010 | NA | 2.23E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 1.28E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 1.03E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | 1.60E-06 | 7.10E-07 | mr1729 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 2.21E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 1.84E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 3.56E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 1.10E-06 | mr1027_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 8.94E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 2.55E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 4.44E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804864010 | NA | 1.76E-07 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |