\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804864010:

Variant ID: vg0804864010 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4864010
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCTACAAATTGGATGTCCGATTTTTGTTGTAAAATTCCGGACGTTATTTCAGTACGTGTAAGAAAAATGTTTCACCACTAGTTTAACTCATGTTTCA[G/A]
ATAAATTTAAATGATGAAACACGTGCGGTTGAATCATGGACTGAAATAATTTGTTTTGAAACATGAAACATTAAAGTTCAATTATTGAAATATTAACAAA

Reverse complement sequence

TTTGTTAATATTTCAATAATTGAACTTTAATGTTTCATGTTTCAAAACAAATTATTTCAGTCCATGATTCAACCGCACGTGTTTCATCATTTAAATTTAT[C/T]
TGAAACATGAGTTAAACTAGTGGTGAAACATTTTTCTTACACGTACTGAAATAACGTCCGGAATTTTACAACAAAAATCGGACATCCAATTTGTAGGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 19.10% 0.63% 2.33% NA
All Indica  2759 73.60% 25.40% 0.87% 0.07% NA
All Japonica  1512 81.50% 11.80% 0.26% 6.42% NA
Aus  269 96.70% 0.70% 0.37% 2.23% NA
Indica I  595 91.30% 8.40% 0.34% 0.00% NA
Indica II  465 58.90% 40.90% 0.22% 0.00% NA
Indica III  913 70.30% 27.80% 1.75% 0.11% NA
Indica Intermediate  786 72.80% 26.50% 0.64% 0.13% NA
Temperate Japonica  767 89.20% 9.50% 0.00% 1.30% NA
Tropical Japonica  504 76.40% 11.30% 0.40% 11.90% NA
Japonica Intermediate  241 68.00% 19.90% 0.83% 11.20% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 72.20% 22.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804864010 G -> A LOC_Os08g08440.1 upstream_gene_variant ; 4906.0bp to feature; MODIFIER silent_mutation Average:49.366; most accessible tissue: Callus, score: 87.585 N N N N
vg0804864010 G -> A LOC_Os08g08450.1 upstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:49.366; most accessible tissue: Callus, score: 87.585 N N N N
vg0804864010 G -> A LOC_Os08g08440-LOC_Os08g08450 intergenic_region ; MODIFIER silent_mutation Average:49.366; most accessible tissue: Callus, score: 87.585 N N N N
vg0804864010 G -> DEL N N silent_mutation Average:49.366; most accessible tissue: Callus, score: 87.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804864010 NA 2.23E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 1.28E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 1.03E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 1.60E-06 7.10E-07 mr1729 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 2.21E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 1.84E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 3.56E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 1.10E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 8.94E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 2.55E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 4.44E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864010 NA 1.76E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251