Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804861961:

Variant ID: vg0804861961 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4861961
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.19, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

CACAGCCTTAGAAAAGGATAAAGTAAAGCATCTCCGAGAAGTACTATGAGCGCTGTCTCTTCTCCAGATTTCAATCCTAGAACTGACTGTTTGAGCTTAA[T/C]
ACGCCACCCGCCGTTCGGAAGTGATTTTTGGCTGTGATAACTTTCTCATTTTTCATTAGCATGTTTTTTACACTGCTAAATTAATGTTATGTTTTTTGTA

Reverse complement sequence

TACAAAAAACATAACATTAATTTAGCAGTGTAAAAAACATGCTAATGAAAAATGAGAAAGTTATCACAGCCAAAAATCACTTCCGAACGGCGGGTGGCGT[A/G]
TTAAGCTCAAACAGTCAGTTCTAGGATTGAAATCTGGAGAAGAGACAGCGCTCATAGTACTTCTCGGAGATGCTTTACTTTATCCTTTTCTAAGGCTGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	27.30%	0.34%	21.31%	NA
All Indica	2759	72.30%	2.20%	0.40%	25.08%	NA
All Japonica	1512	2.00%	79.40%	0.20%	18.39%	NA
Aus	269	95.20%	1.50%	0.00%	3.35%	NA
Indica I	595	87.20%	3.50%	0.84%	8.40%	NA
Indica II	465	55.90%	3.40%	0.43%	40.22%	NA
Indica III	913	72.00%	0.20%	0.22%	27.60%	NA
Indica Intermediate	786	71.20%	2.70%	0.25%	25.83%	NA
Temperate Japonica	767	1.60%	87.50%	0.39%	10.56%	NA
Tropical Japonica	504	3.00%	73.00%	0.00%	24.01%	NA
Japonica Intermediate	241	1.20%	67.20%	0.00%	31.54%	NA
VI/Aromatic	96	91.70%	4.20%	0.00%	4.17%	NA
Intermediate	90	47.80%	23.30%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804861961	T -> C	LOC_Os08g08440.1	upstream_gene_variant ; 2857.0bp to feature; MODIFIER	silent_mutation	Average:74.216; most accessible tissue: Zhenshan97 root, score: 90.023	N	N	N	N
vg0804861961	T -> C	LOC_Os08g08440-LOC_Os08g08450	intergenic_region ; MODIFIER	silent_mutation	Average:74.216; most accessible tissue: Zhenshan97 root, score: 90.023	N	N	N	N
vg0804861961	T -> DEL	N	N	silent_mutation	Average:74.216; most accessible tissue: Zhenshan97 root, score: 90.023	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0804861961	T	C	0.09	0.09	0.09	0.04	0.07	0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804861961	NA	3.98E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	6.17E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	2.61E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	1.92E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	8.20E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	5.87E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	1.70E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	8.04E-07	NA	mr1851	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	1.30E-06	4.53E-09	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	2.69E-06	NA	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	2.83E-08	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	1.63E-26	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804861961	NA	2.80E-27	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251