Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804859344:

Variant ID: vg0804859344 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4859344
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTCGACAAGTGTCCCGGCGGCTGCCAAGTGACACGTGGTGGTGCCGCCTGTCCCAAAATTAGGATGCAAGTGGAACGAGCAAGCACGTTTTCTTACT[T/C]
GCTTATCGCACTTAAAAGATTTTTTTTTTAAGAAAGAAAGTGTACTCTCACATAGACAGTGAATTAGTAAACGAGCTTTTATATAGGTATATAACGAGAT

Reverse complement sequence

ATCTCGTTATATACCTATATAAAAGCTCGTTTACTAATTCACTGTCTATGTGAGAGTACACTTTCTTTCTTAAAAAAAAAATCTTTTAAGTGCGATAAGC[A/G]
AGTAAGAAAACGTGCTTGCTCGTTCCACTTGCATCCTAATTTTGGGACAGGCGGCACCACCACGTGTCACTTGGCAGCCGCCGGGACACTTGTCGAGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 29.00% 1.42% 11.76% NA
All Indica  2759 82.10% 4.60% 1.52% 11.74% NA
All Japonica  1512 4.80% 79.80% 1.39% 13.96% NA
Aus  269 95.50% 1.90% 0.00% 2.60% NA
Indica I  595 88.70% 4.50% 1.51% 5.21% NA
Indica II  465 39.60% 13.10% 4.09% 43.23% NA
Indica III  913 98.80% 0.80% 0.33% 0.11% NA
Indica Intermediate  786 83.00% 4.10% 1.40% 11.58% NA
Temperate Japonica  767 1.30% 87.90% 1.83% 9.00% NA
Tropical Japonica  504 11.50% 73.40% 0.00% 15.08% NA
Japonica Intermediate  241 2.10% 67.60% 2.90% 27.39% NA
VI/Aromatic  96 91.70% 5.20% 0.00% 3.12% NA
Intermediate  90 55.60% 27.80% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804859344 T -> C LOC_Os08g08440.1 upstream_gene_variant ; 240.0bp to feature; MODIFIER silent_mutation Average:96.82; most accessible tissue: Minghui63 root, score: 98.56 N N N N
vg0804859344 T -> C LOC_Os08g08440-LOC_Os08g08450 intergenic_region ; MODIFIER silent_mutation Average:96.82; most accessible tissue: Minghui63 root, score: 98.56 N N N N
vg0804859344 T -> DEL N N silent_mutation Average:96.82; most accessible tissue: Minghui63 root, score: 98.56 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804859344 T C -0.03 -0.03 -0.04 0.01 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804859344 NA 3.66E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 9.62E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 3.61E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 3.79E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.61E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 9.44E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 8.41E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 2.81E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.61E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 3.06E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 7.05E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 4.87E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 5.08E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 3.28E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 5.88E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 2.10E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 3.09E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.20E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 6.54E-09 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 6.14E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 4.84E-06 4.28E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 6.23E-07 2.06E-09 mr1851 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 4.94E-06 NA mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 5.26E-14 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 7.49E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.70E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 9.55E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.16E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.49E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 1.22E-13 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 9.13E-10 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 2.41E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 4.74E-09 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 7.82E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804859344 NA 5.76E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251