\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804856202:

Variant ID: vg0804856202 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4856202
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGTGGTTTGATCTTAAGTTCTGAACTGTTAAGGCTGTGTTTAGTTCACGCCAAAATTAAAAATTTGGTTGAAATTGAAACGATGTGATGGAAAAGTTG[A/G]
AAGTTTGTATGTGTAGGAAAGTTTTGAAGTGATGAAAAAGTTAAAAATTTAAAGAATAACTTTGGAACTAAACACGGCGTAAGTCTCTCTATACATTTTT

Reverse complement sequence

AAAAATGTATAGAGAGACTTACGCCGTGTTTAGTTCCAAAGTTATTCTTTAAATTTTTAACTTTTTCATCACTTCAAAACTTTCCTACACATACAAACTT[T/C]
CAACTTTTCCATCACATCGTTTCAATTTCAACCAAATTTTTAATTTTGGCGTGAACTAAACACAGCCTTAACAGTTCAGAACTTAAGATCAAACCACCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 18.60% 0.02% 2.60% NA
All Indica  2759 94.60% 5.40% 0.00% 0.07% NA
All Japonica  1512 63.70% 29.10% 0.00% 7.21% NA
Aus  269 26.00% 71.00% 0.37% 2.60% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 95.20% 4.70% 0.00% 0.11% NA
Indica Intermediate  786 90.80% 9.00% 0.00% 0.13% NA
Temperate Japonica  767 97.00% 1.70% 0.00% 1.30% NA
Tropical Japonica  504 16.50% 70.40% 0.00% 13.10% NA
Japonica Intermediate  241 56.40% 29.90% 0.00% 13.69% NA
VI/Aromatic  96 14.60% 84.40% 0.00% 1.04% NA
Intermediate  90 75.60% 20.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804856202 A -> G LOC_Os08g08430.1 upstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:62.374; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg0804856202 A -> G LOC_Os08g08440.1 downstream_gene_variant ; 1840.0bp to feature; MODIFIER silent_mutation Average:62.374; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg0804856202 A -> G LOC_Os08g08430-LOC_Os08g08440 intergenic_region ; MODIFIER silent_mutation Average:62.374; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg0804856202 A -> DEL N N silent_mutation Average:62.374; most accessible tissue: Minghui63 root, score: 89.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804856202 NA 1.79E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 5.35E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 5.53E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 8.58E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 1.53E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 3.18E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 6.95E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 3.22E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 5.55E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 1.84E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 4.21E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 4.69E-07 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 1.24E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 9.18E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 8.37E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 8.87E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 4.35E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 1.07E-12 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 7.47E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 1.55E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 2.89E-13 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 4.72E-11 mr1808_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 2.50E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 2.77E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202 NA 9.66E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251