Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804856202:

Variant ID: vg0804856202 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4856202
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGGTGGTTTGATCTTAAGTTCTGAACTGTTAAGGCTGTGTTTAGTTCACGCCAAAATTAAAAATTTGGTTGAAATTGAAACGATGTGATGGAAAAGTTG[A/G]
AAGTTTGTATGTGTAGGAAAGTTTTGAAGTGATGAAAAAGTTAAAAATTTAAAGAATAACTTTGGAACTAAACACGGCGTAAGTCTCTCTATACATTTTT

Reverse complement sequence

AAAAATGTATAGAGAGACTTACGCCGTGTTTAGTTCCAAAGTTATTCTTTAAATTTTTAACTTTTTCATCACTTCAAAACTTTCCTACACATACAAACTT[T/C]
CAACTTTTCCATCACATCGTTTCAATTTCAACCAAATTTTTAATTTTGGCGTGAACTAAACACAGCCTTAACAGTTCAGAACTTAAGATCAAACCACCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	18.60%	0.02%	2.60%	NA
All Indica	2759	94.60%	5.40%	0.00%	0.07%	NA
All Japonica	1512	63.70%	29.10%	0.00%	7.21%	NA
Aus	269	26.00%	71.00%	0.37%	2.60%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	93.10%	6.90%	0.00%	0.00%	NA
Indica III	913	95.20%	4.70%	0.00%	0.11%	NA
Indica Intermediate	786	90.80%	9.00%	0.00%	0.13%	NA
Temperate Japonica	767	97.00%	1.70%	0.00%	1.30%	NA
Tropical Japonica	504	16.50%	70.40%	0.00%	13.10%	NA
Japonica Intermediate	241	56.40%	29.90%	0.00%	13.69%	NA
VI/Aromatic	96	14.60%	84.40%	0.00%	1.04%	NA
Intermediate	90	75.60%	20.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804856202	A -> G	LOC_Os08g08430.1	upstream_gene_variant ; 2110.0bp to feature; MODIFIER	silent_mutation	Average:62.374; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg0804856202	A -> G	LOC_Os08g08440.1	downstream_gene_variant ; 1840.0bp to feature; MODIFIER	silent_mutation	Average:62.374; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg0804856202	A -> G	LOC_Os08g08430-LOC_Os08g08440	intergenic_region ; MODIFIER	silent_mutation	Average:62.374; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg0804856202	A -> DEL	N	N	silent_mutation	Average:62.374; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804856202	NA	1.79E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	5.35E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	5.53E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	8.58E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	1.53E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	3.18E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	6.95E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	3.22E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	5.55E-09	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	1.84E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	4.21E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	4.69E-07	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	1.24E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	9.18E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	8.37E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	8.87E-12	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	4.35E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	1.07E-12	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	7.47E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	1.55E-06	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	2.89E-13	mr1808_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	4.72E-11	mr1808_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	2.50E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	2.77E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804856202	NA	9.66E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251