\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804848546:

Variant ID: vg0804848546 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4848546
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AATCATGGACTAATTAGGCTTAAAAGATTCGTCTCGTGATTTCCTGCCTAATTGTGCAATTAGTTTTTTTATTTATCTATATTTAATACTTCATGCATAT[G/A]
TTCAAAGATTCGATGTGATGTTTTTGGAAAAAAAATTTGGGGAACTAAACGGGGCCAAAATTAGGCAGGAGCATGTTAAATCATCCCATGTCAACCAAGT

Reverse complement sequence

ACTTGGTTGACATGGGATGATTTAACATGCTCCTGCCTAATTTTGGCCCCGTTTAGTTCCCCAAATTTTTTTTCCAAAAACATCACATCGAATCTTTGAA[C/T]
ATATGCATGAAGTATTAAATATAGATAAATAAAAAAACTAATTGCACAATTAGGCAGGAAATCACGAGACGAATCTTTTAAGCCTAATTAGTCCATGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.00% 9.50% 3.13% 68.32% NA
All Indica  2759 2.60% 0.30% 3.30% 93.80% NA
All Japonica  1512 53.20% 27.40% 2.25% 17.06% NA
Aus  269 2.60% 4.10% 6.32% 86.99% NA
Indica I  595 4.50% 0.20% 1.51% 93.78% NA
Indica II  465 4.10% 0.40% 1.94% 93.55% NA
Indica III  913 0.30% 0.20% 4.71% 94.74% NA
Indica Intermediate  786 2.80% 0.50% 3.82% 92.88% NA
Temperate Japonica  767 87.50% 2.00% 0.39% 10.17% NA
Tropical Japonica  504 7.90% 69.60% 2.98% 19.44% NA
Japonica Intermediate  241 39.00% 20.30% 6.64% 34.02% NA
VI/Aromatic  96 2.10% 2.10% 2.08% 93.75% NA
Intermediate  90 14.40% 15.60% 4.44% 65.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804848546 G -> A LOC_Os08g08400.1 upstream_gene_variant ; 4034.0bp to feature; MODIFIER silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0804848546 G -> A LOC_Os08g08410.1 downstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0804848546 G -> A LOC_Os08g08420.1 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0804848546 G -> A LOC_Os08g08430.1 downstream_gene_variant ; 4606.0bp to feature; MODIFIER silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0804848546 G -> A LOC_Os08g08410-LOC_Os08g08420 intergenic_region ; MODIFIER silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0804848546 G -> DEL N N silent_mutation Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804848546 NA 5.75E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 3.28E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 6.81E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 4.95E-07 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 5.38E-06 NA mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 8.73E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 6.16E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 6.25E-07 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.77E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 4.66E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 2.29E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 7.89E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 1.01E-06 1.20E-14 mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.06E-08 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.37E-08 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.19E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.86E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.18E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.35E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 3.16E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 3.38E-09 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 4.46E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.18E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 2.27E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.35E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 4.00E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.60E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 3.49E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.01E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 2.26E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 8.82E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 1.60E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 4.35E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 2.62E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546 NA 3.60E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251