Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804848546:

Variant ID: vg0804848546 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4848546
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AATCATGGACTAATTAGGCTTAAAAGATTCGTCTCGTGATTTCCTGCCTAATTGTGCAATTAGTTTTTTTATTTATCTATATTTAATACTTCATGCATAT[G/A]
TTCAAAGATTCGATGTGATGTTTTTGGAAAAAAAATTTGGGGAACTAAACGGGGCCAAAATTAGGCAGGAGCATGTTAAATCATCCCATGTCAACCAAGT

Reverse complement sequence

ACTTGGTTGACATGGGATGATTTAACATGCTCCTGCCTAATTTTGGCCCCGTTTAGTTCCCCAAATTTTTTTTCCAAAAACATCACATCGAATCTTTGAA[C/T]
ATATGCATGAAGTATTAAATATAGATAAATAAAAAAACTAATTGCACAATTAGGCAGGAAATCACGAGACGAATCTTTTAAGCCTAATTAGTCCATGATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	9.50%	3.13%	68.32%	NA
All Indica	2759	2.60%	0.30%	3.30%	93.80%	NA
All Japonica	1512	53.20%	27.40%	2.25%	17.06%	NA
Aus	269	2.60%	4.10%	6.32%	86.99%	NA
Indica I	595	4.50%	0.20%	1.51%	93.78%	NA
Indica II	465	4.10%	0.40%	1.94%	93.55%	NA
Indica III	913	0.30%	0.20%	4.71%	94.74%	NA
Indica Intermediate	786	2.80%	0.50%	3.82%	92.88%	NA
Temperate Japonica	767	87.50%	2.00%	0.39%	10.17%	NA
Tropical Japonica	504	7.90%	69.60%	2.98%	19.44%	NA
Japonica Intermediate	241	39.00%	20.30%	6.64%	34.02%	NA
VI/Aromatic	96	2.10%	2.10%	2.08%	93.75%	NA
Intermediate	90	14.40%	15.60%	4.44%	65.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804848546	G -> A	LOC_Os08g08400.1	upstream_gene_variant ; 4034.0bp to feature; MODIFIER	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0804848546	G -> A	LOC_Os08g08410.1	downstream_gene_variant ; 551.0bp to feature; MODIFIER	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0804848546	G -> A	LOC_Os08g08420.1	downstream_gene_variant ; 215.0bp to feature; MODIFIER	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0804848546	G -> A	LOC_Os08g08430.1	downstream_gene_variant ; 4606.0bp to feature; MODIFIER	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0804848546	G -> A	LOC_Os08g08410-LOC_Os08g08420	intergenic_region ; MODIFIER	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0804848546	G -> DEL	N	N	silent_mutation	Average:37.732; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804848546	NA	5.75E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	3.28E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	6.81E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	4.95E-07	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	5.38E-06	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	8.73E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	6.16E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	6.25E-07	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.77E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	4.66E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	2.29E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	7.89E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	1.01E-06	1.20E-14	mr1449_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.06E-08	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.37E-08	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.19E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.86E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.18E-15	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.35E-06	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	3.16E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	3.38E-09	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	4.46E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.18E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	2.27E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.35E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	4.00E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.60E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	3.49E-30	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.01E-13	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	2.26E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	8.82E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	1.60E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	4.35E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	2.62E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804848546	NA	3.60E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251