Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804847269:

Variant ID: vg0804847269 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4847269
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATAAATGTCTTAACTCCCTCCTTTCACTTGTCTTTAGATGTCGCGTTACAAGCCTGAGTACTTGTTTGGTGTTGAGGGATTTGTCTAGGAGATGCGTAC[G/A]
ATGTCCTTTGCCATAGGATTTGGGACTGCCCCTTTTTATGCCCAGATTCCTCATGATCGTCACGAAGAGAAGTGCCGAGTCAAAGTCACCTTGAACAGTA

Reverse complement sequence

TACTGTTCAAGGTGACTTTGACTCGGCACTTCTCTTCGTGACGATCATGAGGAATCTGGGCATAAAAAGGGGCAGTCCCAAATCCTATGGCAAAGGACAT[C/T]
GTACGCATCTCCTAGACAAATCCCTCAACACCAAACAAGTACTCAGGCTTGTAACGCGACATCTAAAGACAAGTGAAAGGAGGGAGTTAAGACATTTATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.70%	11.90%	0.36%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	65.10%	34.90%	0.07%	0.00%	NA
Aus	269	92.20%	3.30%	4.46%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	2.90%	0.00%	0.00%	NA
Tropical Japonica	504	20.40%	79.40%	0.20%	0.00%	NA
Japonica Intermediate	241	56.40%	43.60%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	15.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804847269	G -> A	LOC_Os08g08400.1	upstream_gene_variant ; 2757.0bp to feature; MODIFIER	silent_mutation	Average:21.262; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0804847269	G -> A	LOC_Os08g08410.1	upstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:21.262; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0804847269	G -> A	LOC_Os08g08420.1	downstream_gene_variant ; 1492.0bp to feature; MODIFIER	silent_mutation	Average:21.262; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0804847269	G -> A	LOC_Os08g08400-LOC_Os08g08410	intergenic_region ; MODIFIER	silent_mutation	Average:21.262; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804847269	NA	3.94E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	3.28E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	3.31E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	1.67E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	9.57E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	3.60E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	1.80E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	7.83E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	3.90E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	5.35E-07	5.45E-14	mr1449_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	9.82E-06	4.19E-09	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	6.73E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	4.85E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	1.22E-08	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	5.32E-07	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	8.48E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	4.36E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	2.50E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	6.91E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	5.70E-11	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	2.28E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	4.54E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	1.33E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	3.54E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804847269	NA	8.15E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251