\
| Variant ID: vg0804838042 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4838042 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATTGATTGACGATCTATGGGAAACGTTCGACAACCTCCGATGATATCGCCTTATGCTCAATCCAGAGAAGTGCACGTTCAGAGTACCGTCGGGCAAGCT[G/T]
CTCGGTTTCCTCGTATCTGGCAGAGGAATAGAAGCAAATCCCGAGAAGATCAAAGCAATCGAGAACATGAAGTCGCCCAAAAGACTCAAGGAAGTACAAA
TTTGTACTTCCTTGAGTCTTTTGGGCGACTTCATGTTCTCGATTGCTTTGATCTTCTCGGGATTTGCTTCTATTCCTCTGCCAGATACGAGGAAACCGAG[C/A]
AGCTTGCCCGACGGTACTCTGAACGTGCACTTCTCTGGATTGAGCATAAGGCGATATCATCGGAGGTTGTCGAACGTTTCCCATAGATCGTCAATCAATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 2.90% | 13.46% | 30.68% | NA |
| All Indica | 2759 | 33.30% | 4.70% | 19.75% | 42.23% | NA |
| All Japonica | 1512 | 88.60% | 0.00% | 0.93% | 10.52% | NA |
| Aus | 269 | 66.90% | 0.00% | 18.96% | 14.13% | NA |
| Indica I | 595 | 21.50% | 0.00% | 17.98% | 60.50% | NA |
| Indica II | 465 | 29.20% | 24.10% | 18.71% | 27.96% | NA |
| Indica III | 913 | 41.80% | 0.10% | 20.37% | 37.68% | NA |
| Indica Intermediate | 786 | 34.60% | 2.30% | 20.99% | 42.11% | NA |
| Temperate Japonica | 767 | 90.60% | 0.00% | 0.78% | 8.60% | NA |
| Tropical Japonica | 504 | 88.30% | 0.00% | 1.19% | 10.52% | NA |
| Japonica Intermediate | 241 | 82.60% | 0.00% | 0.83% | 16.60% | NA |
| VI/Aromatic | 96 | 20.80% | 2.10% | 13.54% | 63.54% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 14.44% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804838042 | G -> T | LOC_Os08g08390.1 | missense_variant ; p.Ala788Ser; MODERATE | nonsynonymous_codon ; A788S | Average:18.058; most accessible tissue: Minghui63 root, score: 40.262 | unknown | unknown | TOLERATED | 0.83 |
| vg0804838042 | G -> DEL | LOC_Os08g08390.1 | N | frameshift_variant | Average:18.058; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804838042 | NA | 1.15E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 2.18E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 6.25E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 7.24E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 2.69E-07 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 6.29E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 2.77E-07 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 1.39E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | 3.54E-06 | 1.45E-09 | mr1423 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 1.40E-08 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804838042 | NA | 8.02E-09 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |