\
| Variant ID: vg0804837959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4837959 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 74. )
CCAGGGCGCACTTAGCGACCAGCTCGGCAACAACGTCGAGGCATACGTCGACGACATCGTTGTCAAGACTAAGACAAGCGACTCATTGATTGACGATCTA[T/C]
GGGAAACGTTCGACAACCTCCGATGATATCGCCTTATGCTCAATCCAGAGAAGTGCACGTTCAGAGTACCGTCGGGCAAGCTGCTCGGTTTCCTCGTATC
GATACGAGGAAACCGAGCAGCTTGCCCGACGGTACTCTGAACGTGCACTTCTCTGGATTGAGCATAAGGCGATATCATCGGAGGTTGTCGAACGTTTCCC[A/G]
TAGATCGTCAATCAATGAGTCGCTTGTCTTAGTCTTGACAACGATGTCGTCGACGTATGCCTCGACGTTGTTGCCGAGCTGGTCGCTAAGTGCGCCCTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 3.10% | 5.08% | 59.35% | NA |
| All Indica | 2759 | 5.30% | 5.10% | 5.40% | 84.20% | NA |
| All Japonica | 1512 | 88.00% | 0.00% | 0.20% | 11.84% | NA |
| Aus | 269 | 7.10% | 0.00% | 29.74% | 63.20% | NA |
| Indica I | 595 | 8.20% | 0.00% | 1.51% | 90.25% | NA |
| Indica II | 465 | 5.40% | 24.70% | 7.31% | 62.58% | NA |
| Indica III | 913 | 2.20% | 0.70% | 6.24% | 90.91% | NA |
| Indica Intermediate | 786 | 6.60% | 2.50% | 6.23% | 84.61% | NA |
| Temperate Japonica | 767 | 90.60% | 0.00% | 0.13% | 9.26% | NA |
| Tropical Japonica | 504 | 86.90% | 0.00% | 0.40% | 12.70% | NA |
| Japonica Intermediate | 241 | 81.70% | 0.00% | 0.00% | 18.26% | NA |
| VI/Aromatic | 96 | 7.30% | 2.10% | 1.04% | 89.58% | NA |
| Intermediate | 90 | 37.80% | 2.20% | 7.78% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804837959 | T -> C | LOC_Os08g08390.1 | missense_variant ; p.Trp774Arg; MODERATE | nonsynonymous_codon ; W774R | Average:19.588; most accessible tissue: Minghui63 root, score: 41.911 | probably damaging |
2.379 |
TOLERATED | 1.00 |
| vg0804837959 | T -> DEL | LOC_Os08g08390.1 | N | frameshift_variant | Average:19.588; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804837959 | NA | 1.21E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 8.77E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 1.42E-06 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 2.52E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 1.45E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 9.57E-08 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | 1.53E-06 | NA | mr1435 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 8.41E-09 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 1.37E-08 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 4.43E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 4.17E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 2.01E-07 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804837959 | NA | 9.15E-08 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |