\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804833917:

Variant ID: vg0804833917 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4833917
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGATATGCTTGCGCTTTTGGCATCTCGCACCTCATTTATGGTGTGTTCGGATGCTAAAGTTCCCATCCCCTCTCCCTCGTTTTTCGCACGCACGCTTTT[C/T]
AAACTGCTAAACGGTATGTTTTTTTAAAAAAAGTTTCTATACGAAAATTATTTAAAAAAACATATTAATCTAATTTTTTTAAAAAATAGCAAATACTTAA

Reverse complement sequence

TTAAGTATTTGCTATTTTTTAAAAAAATTAGATTAATATGTTTTTTTAAATAATTTTCGTATAGAAACTTTTTTTAAAAAAACATACCGTTTAGCAGTTT[G/A]
AAAAGCGTGCGTGCGAAAAACGAGGGAGAGGGGATGGGAACTTTAGCATCCGAACACACCATAAATGAGGTGCGAGATGCCAAAAGCGCAAGCATATCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 0.70% 1.97% 49.79% NA
All Indica  2759 27.70% 1.20% 2.65% 68.43% NA
All Japonica  1512 88.20% 0.00% 0.07% 11.77% NA
Aus  269 31.60% 0.00% 4.09% 64.31% NA
Indica I  595 29.20% 2.40% 1.68% 66.72% NA
Indica II  465 49.00% 0.00% 1.94% 49.03% NA
Indica III  913 13.00% 1.30% 2.96% 82.69% NA
Indica Intermediate  786 30.90% 1.00% 3.44% 64.63% NA
Temperate Japonica  767 90.50% 0.00% 0.13% 9.39% NA
Tropical Japonica  504 87.30% 0.00% 0.00% 12.70% NA
Japonica Intermediate  241 82.60% 0.00% 0.00% 17.43% NA
VI/Aromatic  96 17.70% 0.00% 1.04% 81.25% NA
Intermediate  90 52.20% 0.00% 7.78% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804833917 C -> T LOC_Os08g08380.1 upstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:81.967; most accessible tissue: Zhenshan97 flower, score: 94.924 N N N N
vg0804833917 C -> T LOC_Os08g08390.1 upstream_gene_variant ; 1442.0bp to feature; MODIFIER silent_mutation Average:81.967; most accessible tissue: Zhenshan97 flower, score: 94.924 N N N N
vg0804833917 C -> T LOC_Os08g08370.1 downstream_gene_variant ; 4669.0bp to feature; MODIFIER silent_mutation Average:81.967; most accessible tissue: Zhenshan97 flower, score: 94.924 N N N N
vg0804833917 C -> T LOC_Os08g08380-LOC_Os08g08390 intergenic_region ; MODIFIER silent_mutation Average:81.967; most accessible tissue: Zhenshan97 flower, score: 94.924 N N N N
vg0804833917 C -> DEL N N silent_mutation Average:81.967; most accessible tissue: Zhenshan97 flower, score: 94.924 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804833917 C T 0.06 0.05 0.06 0.05 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804833917 NA 7.22E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 3.08E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 2.97E-06 7.36E-09 mr1177 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 2.97E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 6.96E-06 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 8.28E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 2.67E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 6.63E-06 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 1.42E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 1.07E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 3.79E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 5.69E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 4.83E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 1.28E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 6.95E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 4.85E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 7.86E-06 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 6.28E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 5.50E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 6.31E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804833917 NA 8.92E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251