\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804772741:

Variant ID: vg0804772741 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4772741
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GATGTATAATTTGTTCTTTTTTTTAGAACTTGTGATTCATTGTATGGATCTGAGATGTATAATCGATCTGTGATGCATTTGATTTTTGTGTAATTTTGAT[G/A]
TATTTGATTTGTGTGTAACCAACTTAGGATTTGTATTTGTGATGTGGATGATTTGGGATGTTATTTTGATTTGGGGATTTGGGGTTTGATTTGTATATAC

Reverse complement sequence

GTATATACAAATCAAACCCCAAATCCCCAAATCAAAATAACATCCCAAATCATCCACATCACAAATACAAATCCTAAGTTGGTTACACACAAATCAAATA[C/T]
ATCAAAATTACACAAAAATCAAATGCATCACAGATCGATTATACATCTCAGATCCATACAATGAATCACAAGTTCTAAAAAAAAGAACAAATTATACATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 37.00% 0.17% 23.04% NA
All Indica  2759 26.20% 58.90% 0.07% 14.82% NA
All Japonica  1512 55.60% 1.40% 0.20% 42.79% NA
Aus  269 73.20% 23.80% 0.37% 2.60% NA
Indica I  595 4.20% 89.40% 0.17% 6.22% NA
Indica II  465 17.80% 26.70% 0.00% 55.48% NA
Indica III  913 42.50% 57.10% 0.00% 0.44% NA
Indica Intermediate  786 28.90% 57.00% 0.13% 13.99% NA
Temperate Japonica  767 86.30% 0.80% 0.00% 12.91% NA
Tropical Japonica  504 17.30% 2.00% 0.40% 80.36% NA
Japonica Intermediate  241 38.20% 2.10% 0.41% 59.34% NA
VI/Aromatic  96 89.60% 3.10% 1.04% 6.25% NA
Intermediate  90 38.90% 37.80% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804772741 G -> A LOC_Os08g08310.1 downstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0804772741 G -> A LOC_Os08g08310-LOC_Os08g08320 intergenic_region ; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0804772741 G -> DEL N N silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804772741 NA 2.27E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 7.58E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 1.45E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 1.20E-07 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 5.14E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 5.70E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 2.87E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 4.62E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 5.07E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 3.72E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 2.77E-06 8.79E-08 mr1531_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 1.92E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 4.15E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 2.53E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 1.62E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804772741 NA 9.01E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251