Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804699109:

Variant ID: vg0804699109 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4699109
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.18, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCCTAGGGGGGATTTATCTTTACGATTGAGTTGAAAGTGTTTTCTAGCATATTTTATCAGTTTTTTAGATATATTTTAAGTCGTGACACGTTTTTAGT[A/C]
TATAAATAAATTACACAAAATTTGGATATCCTGTAGCAAAAATTGCCTAATTTGATGAAGTATGTGGAATGTCACGCATAGAGTCACTGATGAACCAATG

Reverse complement sequence

CATTGGTTCATCAGTGACTCTATGCGTGACATTCCACATACTTCATCAAATTAGGCAATTTTTGCTACAGGATATCCAAATTTTGTGTAATTTATTTATA[T/G]
ACTAAAAACGTGTCACGACTTAAAATATATCTAAAAAACTGATAAAATATGCTAGAAAACACTTTCAACTCAATCGTAAAGATAAATCCCCCCTAGGACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.20% 0.02% 0.00% NA
All Indica  2759 91.30% 8.70% 0.00% 0.00% NA
All Japonica  1512 12.20% 87.70% 0.07% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 91.00% 9.00% 0.00% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 85.10% 14.90% 0.00% 0.00% NA
Temperate Japonica  767 9.10% 90.70% 0.13% 0.00% NA
Tropical Japonica  504 14.30% 85.70% 0.00% 0.00% NA
Japonica Intermediate  241 17.80% 82.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804699109 A -> C LOC_Os08g08220.1 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:64.74; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0804699109 A -> C LOC_Os08g08220.3 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:64.74; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0804699109 A -> C LOC_Os08g08220.2 upstream_gene_variant ; 1917.0bp to feature; MODIFIER silent_mutation Average:64.74; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0804699109 A -> C LOC_Os08g08210.1 downstream_gene_variant ; 2379.0bp to feature; MODIFIER silent_mutation Average:64.74; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0804699109 A -> C LOC_Os08g08210-LOC_Os08g08220 intergenic_region ; MODIFIER silent_mutation Average:64.74; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804699109 NA 4.65E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 6.70E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 4.43E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 5.08E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 8.26E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 1.26E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 2.08E-19 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 6.68E-19 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 2.11E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 3.13E-06 3.54E-07 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 8.96E-07 2.21E-50 mr1721_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 7.32E-06 NA mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 7.18E-12 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804699109 NA 7.23E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251