\
| Variant ID: vg0804660474 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4660474 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )
TTTCGCATGCGGCCGTCTTAAGTGACCGCATGCGAAGATCGATCTTCGCATGCGGCTGCGACGGCCGCATGCGCAAATGGTAATCTTCGCAGACCATTTC[G/A]
CGCATGCGGGCCGGCCAACCGCATGTGAAGATCGATTCCGCCCGTATGCAAAAACGCTTTCTGTAGTAGTGGTATGTACGATTACTTAAGAAACTAGTAA
TTACTAGTTTCTTAAGTAATCGTACATACCACTACTACAGAAAGCGTTTTTGCATACGGGCGGAATCGATCTTCACATGCGGTTGGCCGGCCCGCATGCG[C/T]
GAAATGGTCTGCGAAGATTACCATTTGCGCATGCGGCCGTCGCAGCCGCATGCGAAGATCGATCTTCGCATGCGGTCACTTAAGACGGCCGCATGCGAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 32.70% | 4.95% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 2.60% | 7.90% | 0.00% | NA |
| All Japonica | 1512 | 4.60% | 94.80% | 0.53% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.00% | 5.50% | 13.45% | 0.00% | NA |
| Indica II | 465 | 81.10% | 4.10% | 14.84% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 2.40% | 8.78% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 97.90% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 11.10% | 88.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 28.90% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804660474 | G -> A | LOC_Os08g08180.1 | downstream_gene_variant ; 459.0bp to feature; MODIFIER | silent_mutation | Average:29.662; most accessible tissue: Callus, score: 55.279 | N | N | N | N |
| vg0804660474 | G -> A | LOC_Os08g08180-LOC_Os08g08190 | intergenic_region ; MODIFIER | silent_mutation | Average:29.662; most accessible tissue: Callus, score: 55.279 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804660474 | NA | 1.95E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 2.78E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 3.89E-32 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 2.47E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 4.49E-24 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 4.51E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 2.52E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | 1.19E-06 | NA | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 2.47E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 1.18E-27 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 2.09E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804660474 | NA | 8.53E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |