\
| Variant ID: vg0804653438 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4653438 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAATGCTTAGGAATAAACCCTAAAAAGTAAATTGACTAAGTAAATAACTAAAGTGCAACTTAAAATAATATTTGGTGAGGATAGAAATGAGTAAAATATT[C/A]
TTACGATTATATTTGTATTAATTAAATTTAAAAGTGTCGGAACAAGAATTAACCCTAATTAAAAATTCAAATAAATTATACCAATAAAATATGAGTAATA
TATTACTCATATTTTATTGGTATAATTTATTTGAATTTTTAATTAGGGTTAATTCTTGTTCCGACACTTTTAAATTTAATTAATACAAATATAATCGTAA[G/T]
AATATTTTACTCATTTCTATCCTCACCAAATATTATTTTAAGTTGCACTTTAGTTATTTACTTAGTCAATTTACTTTTTAGGGTTTATTCCTAAGCATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 25.40% | 2.79% | 10.62% | NA |
| All Indica | 2759 | 88.00% | 0.80% | 3.55% | 7.65% | NA |
| All Japonica | 1512 | 3.70% | 76.30% | 1.65% | 18.39% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.23% | 0.74% | NA |
| Indica I | 595 | 79.00% | 0.20% | 7.06% | 13.78% | NA |
| Indica II | 465 | 94.40% | 2.40% | 1.29% | 1.94% | NA |
| Indica III | 913 | 88.20% | 0.10% | 2.52% | 9.20% | NA |
| Indica Intermediate | 786 | 91.00% | 1.00% | 3.44% | 4.58% | NA |
| Temperate Japonica | 767 | 2.60% | 88.30% | 0.13% | 9.00% | NA |
| Tropical Japonica | 504 | 5.20% | 74.60% | 3.37% | 16.87% | NA |
| Japonica Intermediate | 241 | 4.10% | 41.50% | 2.90% | 51.45% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 26.70% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804653438 | C -> A | LOC_Os08g08160.1 | upstream_gene_variant ; 4730.0bp to feature; MODIFIER | silent_mutation | Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804653438 | C -> A | LOC_Os08g08180.1 | upstream_gene_variant ; 3866.0bp to feature; MODIFIER | silent_mutation | Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804653438 | C -> A | LOC_Os08g08170.1 | downstream_gene_variant ; 1048.0bp to feature; MODIFIER | silent_mutation | Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804653438 | C -> A | LOC_Os08g08170-LOC_Os08g08180 | intergenic_region ; MODIFIER | silent_mutation | Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804653438 | C -> DEL | N | N | silent_mutation | Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804653438 | NA | 2.22E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 7.46E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 1.10E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | 2.06E-06 | NA | mr1573 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 2.35E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 1.58E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 4.28E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 1.14E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 8.80E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804653438 | NA | 2.42E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |