Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804653438:

Variant ID: vg0804653438 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4653438
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATGCTTAGGAATAAACCCTAAAAAGTAAATTGACTAAGTAAATAACTAAAGTGCAACTTAAAATAATATTTGGTGAGGATAGAAATGAGTAAAATATT[C/A]
TTACGATTATATTTGTATTAATTAAATTTAAAAGTGTCGGAACAAGAATTAACCCTAATTAAAAATTCAAATAAATTATACCAATAAAATATGAGTAATA

Reverse complement sequence

TATTACTCATATTTTATTGGTATAATTTATTTGAATTTTTAATTAGGGTTAATTCTTGTTCCGACACTTTTAAATTTAATTAATACAAATATAATCGTAA[G/T]
AATATTTTACTCATTTCTATCCTCACCAAATATTATTTTAAGTTGCACTTTAGTTATTTACTTAGTCAATTTACTTTTTAGGGTTTATTCCTAAGCATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	25.40%	2.79%	10.62%	NA
All Indica	2759	88.00%	0.80%	3.55%	7.65%	NA
All Japonica	1512	3.70%	76.30%	1.65%	18.39%	NA
Aus	269	97.00%	0.00%	2.23%	0.74%	NA
Indica I	595	79.00%	0.20%	7.06%	13.78%	NA
Indica II	465	94.40%	2.40%	1.29%	1.94%	NA
Indica III	913	88.20%	0.10%	2.52%	9.20%	NA
Indica Intermediate	786	91.00%	1.00%	3.44%	4.58%	NA
Temperate Japonica	767	2.60%	88.30%	0.13%	9.00%	NA
Tropical Japonica	504	5.20%	74.60%	3.37%	16.87%	NA
Japonica Intermediate	241	4.10%	41.50%	2.90%	51.45%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	57.80%	26.70%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804653438	C -> A	LOC_Os08g08160.1	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0804653438	C -> A	LOC_Os08g08180.1	upstream_gene_variant ; 3866.0bp to feature; MODIFIER	silent_mutation	Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0804653438	C -> A	LOC_Os08g08170.1	downstream_gene_variant ; 1048.0bp to feature; MODIFIER	silent_mutation	Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0804653438	C -> A	LOC_Os08g08170-LOC_Os08g08180	intergenic_region ; MODIFIER	silent_mutation	Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0804653438	C -> DEL	N	N	silent_mutation	Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804653438	NA	2.22E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	7.46E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	1.10E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	2.06E-06	NA	mr1573	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	2.35E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	1.58E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	4.28E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	1.14E-24	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	8.80E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438	NA	2.42E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251