\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804653438:

Variant ID: vg0804653438 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4653438
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGCTTAGGAATAAACCCTAAAAAGTAAATTGACTAAGTAAATAACTAAAGTGCAACTTAAAATAATATTTGGTGAGGATAGAAATGAGTAAAATATT[C/A]
TTACGATTATATTTGTATTAATTAAATTTAAAAGTGTCGGAACAAGAATTAACCCTAATTAAAAATTCAAATAAATTATACCAATAAAATATGAGTAATA

Reverse complement sequence

TATTACTCATATTTTATTGGTATAATTTATTTGAATTTTTAATTAGGGTTAATTCTTGTTCCGACACTTTTAAATTTAATTAATACAAATATAATCGTAA[G/T]
AATATTTTACTCATTTCTATCCTCACCAAATATTATTTTAAGTTGCACTTTAGTTATTTACTTAGTCAATTTACTTTTTAGGGTTTATTCCTAAGCATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 25.40% 2.79% 10.62% NA
All Indica  2759 88.00% 0.80% 3.55% 7.65% NA
All Japonica  1512 3.70% 76.30% 1.65% 18.39% NA
Aus  269 97.00% 0.00% 2.23% 0.74% NA
Indica I  595 79.00% 0.20% 7.06% 13.78% NA
Indica II  465 94.40% 2.40% 1.29% 1.94% NA
Indica III  913 88.20% 0.10% 2.52% 9.20% NA
Indica Intermediate  786 91.00% 1.00% 3.44% 4.58% NA
Temperate Japonica  767 2.60% 88.30% 0.13% 9.00% NA
Tropical Japonica  504 5.20% 74.60% 3.37% 16.87% NA
Japonica Intermediate  241 4.10% 41.50% 2.90% 51.45% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 57.80% 26.70% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804653438 C -> A LOC_Os08g08160.1 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0804653438 C -> A LOC_Os08g08180.1 upstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0804653438 C -> A LOC_Os08g08170.1 downstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0804653438 C -> A LOC_Os08g08170-LOC_Os08g08180 intergenic_region ; MODIFIER silent_mutation Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0804653438 C -> DEL N N silent_mutation Average:15.666; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804653438 NA 2.22E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 7.46E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 1.10E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 2.06E-06 NA mr1573 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 2.35E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 1.58E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 4.28E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 1.14E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 8.80E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804653438 NA 2.42E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251