\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804616740:

Variant ID: vg0804616740 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4616740
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTTCGTGTTCAACTTTGATTGTCCGTCTTATATAAATTTTTTTATAATTCGTATTTTTATTATTGTTAGATGATAAAACATGATTAATATTTTATG[C/T]
GTAACTTGTCTTTTTATTTTTTTCATAATTTTTTTAAATAAGACGGACACGTTGGACACGGAAACCATGGTTTGTCTTTTTTTACCGAGGGAGTACTAAG

Reverse complement sequence

CTTAGTACTCCCTCGGTAAAAAAAGACAAACCATGGTTTCCGTGTCCAACGTGTCCGTCTTATTTAAAAAAATTATGAAAAAAATAAAAAGACAAGTTAC[G/A]
CATAAAATATTAATCATGTTTTATCATCTAACAATAATAAAAATACGAATTATAAAAAAATTTATATAAGACGGACAATCAAAGTTGAACACGAAAAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 26.40% 8.46% 18.07% NA
All Indica  2759 26.00% 34.10% 12.21% 27.73% NA
All Japonica  1512 95.80% 0.30% 0.40% 3.44% NA
Aus  269 3.00% 75.50% 15.24% 6.32% NA
Indica I  595 39.30% 11.30% 13.45% 35.97% NA
Indica II  465 39.40% 41.30% 5.81% 13.55% NA
Indica III  913 3.10% 46.20% 16.43% 34.28% NA
Indica Intermediate  786 34.50% 33.10% 10.18% 22.26% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 88.50% 0.80% 0.99% 9.72% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 8.30% 79.20% 9.38% 3.12% NA
Intermediate  90 47.80% 25.60% 7.78% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804616740 C -> T LOC_Os08g08120.1 upstream_gene_variant ; 4006.0bp to feature; MODIFIER silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N
vg0804616740 C -> T LOC_Os08g08120.3 upstream_gene_variant ; 4006.0bp to feature; MODIFIER silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N
vg0804616740 C -> T LOC_Os08g08120.2 upstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N
vg0804616740 C -> T LOC_Os08g08130.1 downstream_gene_variant ; 1254.0bp to feature; MODIFIER silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N
vg0804616740 C -> T LOC_Os08g08120-LOC_Os08g08130 intergenic_region ; MODIFIER silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N
vg0804616740 C -> DEL N N silent_mutation Average:62.074; most accessible tissue: Minghui63 root, score: 89.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804616740 NA 7.32E-09 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804616740 NA 4.04E-06 mr1815 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251