\
| Variant ID: vg0804453676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4453676 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )
CATCAGTTGACCATCTAATTTCTATAAAAATAACCATTTTACCCTTTGGATGAACACAAAAAATTATGAATTACATTATTAAAAATGTAAAAGTTTGTCG[C/T]
ATGAGACTATTATAGTTACGAGTTTGTTGTGCAATGCATTATTTATCAAAAAAATATTTTTAGATAATGAAATAAAAAAAATATTTTTTTTAACAAAAGG
CCTTTTGTTAAAAAAAATATTTTTTTTATTTCATTATCTAAAAATATTTTTTTGATAAATAATGCATTGCACAACAAACTCGTAACTATAATAGTCTCAT[G/A]
CGACAAACTTTTACATTTTTAATAATGTAATTCATAATTTTTTGTGTTCATCCAAAGGGTAAAATGGTTATTTTTATAGAAATTAGATGGTCAACTGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.80% | 8.50% | 27.17% | 30.51% | NA |
| All Indica | 2759 | 4.00% | 13.90% | 44.04% | 38.02% | NA |
| All Japonica | 1512 | 94.80% | 0.00% | 0.86% | 4.30% | NA |
| Aus | 269 | 1.50% | 5.60% | 12.27% | 80.67% | NA |
| Indica I | 595 | 6.40% | 10.40% | 46.89% | 36.30% | NA |
| Indica II | 465 | 5.20% | 9.90% | 38.71% | 46.24% | NA |
| Indica III | 913 | 1.50% | 19.50% | 45.78% | 33.19% | NA |
| Indica Intermediate | 786 | 4.50% | 12.50% | 43.00% | 40.08% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.78% | 1.17% | NA |
| Tropical Japonica | 504 | 88.70% | 0.00% | 0.60% | 10.71% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 4.17% | 81.25% | NA |
| Intermediate | 90 | 40.00% | 2.20% | 21.11% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804453676 | C -> T | LOC_Os08g07900.1 | downstream_gene_variant ; 883.0bp to feature; MODIFIER | silent_mutation | Average:12.243; most accessible tissue: Callus, score: 57.265 | N | N | N | N |
| vg0804453676 | C -> T | LOC_Os08g07890-LOC_Os08g07900 | intergenic_region ; MODIFIER | silent_mutation | Average:12.243; most accessible tissue: Callus, score: 57.265 | N | N | N | N |
| vg0804453676 | C -> DEL | N | N | silent_mutation | Average:12.243; most accessible tissue: Callus, score: 57.265 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804453676 | 1.18E-06 | 1.18E-06 | mr1473 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804453676 | 6.41E-06 | 6.41E-06 | mr1473 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804453676 | 4.46E-07 | 4.46E-07 | mr1664 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804453676 | 2.14E-06 | 2.14E-06 | mr1664 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |