\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804452573:

Variant ID: vg0804452573 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4452573
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATATTACCATCCGCCGATTGTCTTTATATCATTATTTACATCAAGTGTCAGATTCTACATTAACCATATAGCCGATTGTTCAAGACCTATCGACATC[G/A]
GCTGGTATCAGCATCGGCATCGGCTGGAACTAATCCATCGGCTTATCAGCTGATCGGCTCATCAGTCGATCGGCTCTTTCATCTGATTTTTATATATCTT

Reverse complement sequence

AAGATATATAAAAATCAGATGAAAGAGCCGATCGACTGATGAGCCGATCAGCTGATAAGCCGATGGATTAGTTCCAGCCGATGCCGATGCTGATACCAGC[C/T]
GATGTCGATAGGTCTTGAACAATCGGCTATATGGTTAATGTAGAATCTGACACTTGATGTAAATAATGATATAAAGACAATCGGCGGATGGTAATATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.90% 6.50% 1.46% 65.15% NA
All Indica  2759 4.20% 0.20% 1.09% 94.53% NA
All Japonica  1512 73.40% 19.40% 2.31% 4.89% NA
Aus  269 1.50% 0.00% 0.37% 98.14% NA
Indica I  595 6.10% 0.00% 0.50% 93.45% NA
Indica II  465 6.20% 0.20% 0.86% 92.69% NA
Indica III  913 1.60% 0.10% 1.42% 96.82% NA
Indica Intermediate  786 4.60% 0.40% 1.27% 93.77% NA
Temperate Japonica  767 95.30% 0.10% 3.13% 1.43% NA
Tropical Japonica  504 31.70% 55.20% 1.79% 11.31% NA
Japonica Intermediate  241 90.90% 5.80% 0.83% 2.49% NA
VI/Aromatic  96 14.60% 0.00% 1.04% 84.38% NA
Intermediate  90 30.00% 10.00% 2.22% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804452573 G -> A LOC_Os08g07890.1 downstream_gene_variant ; 4382.0bp to feature; MODIFIER silent_mutation Average:12.076; most accessible tissue: Callus, score: 58.146 N N N N
vg0804452573 G -> A LOC_Os08g07900.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:12.076; most accessible tissue: Callus, score: 58.146 N N N N
vg0804452573 G -> A LOC_Os08g07890-LOC_Os08g07900 intergenic_region ; MODIFIER silent_mutation Average:12.076; most accessible tissue: Callus, score: 58.146 N N N N
vg0804452573 G -> DEL N N silent_mutation Average:12.076; most accessible tissue: Callus, score: 58.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804452573 NA 1.88E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 8.78E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 2.01E-07 NA mr1136 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 4.58E-06 NA mr1136 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 1.01E-06 NA mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 1.53E-06 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 2.98E-07 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 1.60E-07 NA mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 2.07E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 7.02E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 5.12E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 3.29E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 2.09E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 1.94E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 2.34E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 8.94E-06 NA mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 1.98E-06 NA mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 6.05E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 1.16E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 6.50E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 8.86E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804452573 NA 9.33E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251