\
| Variant ID: vg0804435056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4435056 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 76. )
TCTATAGCTCTCTAATTCATTGCCTCGTTTTTCTCTATAGACTATCTCTAGGTTAGTAGATAACTTTGCTCTCTCTCTTCATTTAATCTCTTCCAAGTAG[A/G]
AAAATATGCTGACATGGATCTCTTGTAGATAGCATATAGATAACCATTGAGGGTGCCCTTAGGTATGACGCGGCACTATGGAGGCCTAAGAGTTACGGTG
CACCGTAACTCTTAGGCCTCCATAGTGCCGCGTCATACCTAAGGGCACCCTCAATGGTTATCTATATGCTATCTACAAGAGATCCATGTCAGCATATTTT[T/C]
CTACTTGGAAGAGATTAAATGAAGAGAGAGAGCAAAGTTATCTACTAACCTAGAGATAGTCTATAGAGAAAAACGAGGCAATGAATTAGAGAGCTATAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.50% | 7.30% | 1.48% | 64.73% | NA |
| All Indica | 2759 | 3.00% | 1.10% | 1.49% | 94.49% | NA |
| All Japonica | 1512 | 75.30% | 19.60% | 0.13% | 4.96% | NA |
| Aus | 269 | 1.10% | 0.00% | 8.18% | 90.71% | NA |
| Indica I | 595 | 5.90% | 0.00% | 1.34% | 92.77% | NA |
| Indica II | 465 | 3.70% | 2.40% | 2.15% | 91.83% | NA |
| Indica III | 913 | 0.70% | 1.00% | 0.77% | 97.59% | NA |
| Indica Intermediate | 786 | 3.10% | 1.10% | 2.04% | 93.77% | NA |
| Temperate Japonica | 767 | 83.40% | 14.70% | 0.26% | 1.56% | NA |
| Tropical Japonica | 504 | 76.60% | 12.10% | 0.00% | 11.31% | NA |
| Japonica Intermediate | 241 | 46.90% | 50.60% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 6.20% | 7.30% | 2.08% | 84.38% | NA |
| Intermediate | 90 | 26.70% | 12.20% | 3.33% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804435056 | A -> G | LOC_Os08g07880.1 | downstream_gene_variant ; 743.0bp to feature; MODIFIER | silent_mutation | Average:9.547; most accessible tissue: Callus, score: 42.161 | N | N | N | N |
| vg0804435056 | A -> G | LOC_Os08g07880-LOC_Os08g07890 | intergenic_region ; MODIFIER | silent_mutation | Average:9.547; most accessible tissue: Callus, score: 42.161 | N | N | N | N |
| vg0804435056 | A -> DEL | N | N | silent_mutation | Average:9.547; most accessible tissue: Callus, score: 42.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804435056 | 6.89E-08 | NA | mr1174_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | NA | 1.11E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | NA | 2.68E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | 3.34E-08 | NA | mr1347_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | 5.95E-06 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | 4.95E-06 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | NA | 1.78E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | NA | 1.46E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804435056 | NA | 8.79E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |