Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0804409772:

Variant ID: vg0804409772 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4409772
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CATACACAGTGGTAGAACACACTCAAACCAGGCAAAAGTCAGTGAGAAGGAGCCGACACCAATCTGCAACATACTTTTGTCTTGAAAGAACATACAGACC[A/T]
TTTATATATTTTTCATCCTTTACTTGACAATAGCATGGTGTACCATCAGCATGTGCTTATTGACAACCCAAATGTGAACTGTGAGGTACTGATGCAACAT

Reverse complement sequence

ATGTTGCATCAGTACCTCACAGTTCACATTTGGGTTGTCAATAAGCACATGCTGATGGTACACCATGCTATTGTCAAGTAAAGGATGAAAAATATATAAA[T/A]
GGTCTGTATGTTCTTTCAAGACAAAAGTATGTTGCAGATTGGTGTCGGCTCCTTCTCACTGACTTTTGCCTGGTTTGAGTGTGTTCTACCACTGTGTATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.40% 0.40% 3.77% 61.47% NA
All Indica  2759 4.90% 0.60% 4.49% 90.03% NA
All Japonica  1512 95.10% 0.00% 2.98% 1.92% NA
Aus  269 1.50% 0.40% 0.74% 97.40% NA
Indica I  595 6.90% 0.50% 2.52% 90.08% NA
Indica II  465 6.90% 0.90% 9.89% 82.37% NA
Indica III  913 2.40% 0.70% 3.07% 93.87% NA
Indica Intermediate  786 5.10% 0.40% 4.45% 90.08% NA
Temperate Japonica  767 98.40% 0.00% 0.26% 1.30% NA
Tropical Japonica  504 88.90% 0.00% 8.33% 2.78% NA
Japonica Intermediate  241 97.50% 0.00% 0.41% 2.07% NA
VI/Aromatic  96 14.60% 0.00% 0.00% 85.42% NA
Intermediate  90 38.90% 0.00% 7.78% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804409772 A -> T LOC_Os08g07850.1 intron_variant ; MODIFIER silent_mutation Average:33.639; most accessible tissue: Callus, score: 70.651 N N N N
vg0804409772 A -> DEL N N silent_mutation Average:33.639; most accessible tissue: Callus, score: 70.651 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804409772 NA 4.98E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 3.53E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.92E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 8.67E-46 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 7.69E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 4.21E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.08E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.17E-28 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 4.28E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 5.58E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 2.14E-25 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 6.53E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.82E-25 mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.75E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 6.35E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 5.49E-06 3.89E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 9.84E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.21E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.93E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.35E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 3.13E-34 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 2.43E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 7.85E-72 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.11E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 2.00E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.34E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.12E-51 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.47E-18 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 1.82E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 2.78E-28 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 4.25E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804409772 NA 5.77E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251