\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804382774:

Variant ID: vg0804382774 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4382774
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCTTGGGTCACGCCTTCACCGCTCCGCTCGGCACTGCCGCCTCACTTCCTCTCTGCTAAGGAAAATACACTGAGAGAGGAGAGAGAGGGGGATGAAA[T/A]
GTGAAGGAGAGGTAGTAGTAGGACCCACCACAAGTGACCTGCACTATGGAGCACGTAGCAAATACAATTCTTAGTGTATGTGGCATGTGAGGAAATGTAA

Reverse complement sequence

TTACATTTCCTCACATGCCACATACACTAAGAATTGTATTTGCTACGTGCTCCATAGTGCAGGTCACTTGTGGTGGGTCCTACTACTACCTCTCCTTCAC[A/T]
TTTCATCCCCCTCTCTCTCCTCTCTCAGTGTATTTTCCTTAGCAGAGAGGAAGTGAGGCGGCAGTGCCGAGCGGAGCGGTGAAGGCGTGACCCAAGCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 28.90% 0.85% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 13.40% 84.10% 2.45% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 10.40% 85.10% 4.43% 0.00% NA
Tropical Japonica  504 19.80% 79.80% 0.40% 0.00% NA
Japonica Intermediate  241 9.50% 90.00% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804382774 T -> A LOC_Os08g07820.1 downstream_gene_variant ; 3511.0bp to feature; MODIFIER silent_mutation Average:73.646; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg0804382774 T -> A LOC_Os08g07830.1 downstream_gene_variant ; 2994.0bp to feature; MODIFIER silent_mutation Average:73.646; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg0804382774 T -> A LOC_Os08g07830.2 downstream_gene_variant ; 2994.0bp to feature; MODIFIER silent_mutation Average:73.646; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg0804382774 T -> A LOC_Os08g07820-LOC_Os08g07830 intergenic_region ; MODIFIER silent_mutation Average:73.646; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804382774 T A 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804382774 9.32E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 4.52E-06 4.29E-49 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 2.60E-06 2.82E-26 mr1181 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 1.59E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 6.49E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 1.24E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 2.20E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 2.79E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 3.16E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 1.20E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 1.73E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 6.02E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 1.86E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 2.00E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 5.49E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804382774 NA 7.99E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251