\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804370126:

Variant ID: vg0804370126 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4370126
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAAAAAAAATAAAAATGAATCTGCATGACTGTGTAATTGCCTTCTTAATTATGTTCTCAGTACAAGAACTATCTTTTTATTAGATCCGATGGATTT[A/T]
GGAACTGGAAGCTAAGTGCTACTGCATCTAGCAACCGTTGATTCCACGGATTTTTCTTTTGATTGTTGTCAACTGGCGGCTTGGTTTTAATCTCTTATTA

Reverse complement sequence

TAATAAGAGATTAAAACCAAGCCGCCAGTTGACAACAATCAAAAGAAAAATCCGTGGAATCAACGGTTGCTAGATGCAGTAGCACTTAGCTTCCAGTTCC[T/A]
AAATCCATCGGATCTAATAAAAAGATAGTTCTTGTACTGAGAACATAATTAAGAAGGCAATTACACAGTCATGCAGATTCATTTTTATTTTTTTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 33.50% 0.21% 0.99% NA
All Indica  2759 96.00% 3.80% 0.22% 0.00% NA
All Japonica  1512 2.10% 95.00% 0.00% 2.91% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 93.10% 6.20% 0.67% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 89.10% 0.00% 8.53% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 86.50% 9.40% 4.17% 0.00% NA
Intermediate  90 60.00% 36.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804370126 A -> T LOC_Os08g07800.1 upstream_gene_variant ; 3487.0bp to feature; MODIFIER silent_mutation Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0804370126 A -> T LOC_Os08g07810.1 upstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0804370126 A -> T LOC_Os08g07790.1 downstream_gene_variant ; 4607.0bp to feature; MODIFIER silent_mutation Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0804370126 A -> T LOC_Os08g07800-LOC_Os08g07810 intergenic_region ; MODIFIER silent_mutation Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0804370126 A -> DEL N N silent_mutation Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804370126 4.24E-06 1.49E-07 mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.08E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.16E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.15E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 2.25E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 7.81E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 2.77E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.50E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 5.89E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 6.34E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 5.54E-06 5.54E-06 mr1666 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.78E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 3.06E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.27E-35 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.78E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.17E-32 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 7.19E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.57E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.25E-51 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 1.68E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 2.69E-07 4.59E-10 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 8.57E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 2.78E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 3.29E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 8.58E-26 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 3.80E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 9.17E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 4.47E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 2.17E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126 NA 3.08E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251