Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804370126:

Variant ID: vg0804370126 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4370126
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTAAAAAAAATAAAAATGAATCTGCATGACTGTGTAATTGCCTTCTTAATTATGTTCTCAGTACAAGAACTATCTTTTTATTAGATCCGATGGATTT[A/T]
GGAACTGGAAGCTAAGTGCTACTGCATCTAGCAACCGTTGATTCCACGGATTTTTCTTTTGATTGTTGTCAACTGGCGGCTTGGTTTTAATCTCTTATTA

Reverse complement sequence

TAATAAGAGATTAAAACCAAGCCGCCAGTTGACAACAATCAAAAGAAAAATCCGTGGAATCAACGGTTGCTAGATGCAGTAGCACTTAGCTTCCAGTTCC[T/A]
AAATCCATCGGATCTAATAAAAAGATAGTTCTTGTACTGAGAACATAATTAAGAAGGCAATTACACAGTCATGCAGATTCATTTTTATTTTTTTTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	33.50%	0.21%	0.99%	NA
All Indica	2759	96.00%	3.80%	0.22%	0.00%	NA
All Japonica	1512	2.10%	95.00%	0.00%	2.91%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	93.10%	6.20%	0.67%	0.00%	NA
Indica II	465	95.10%	4.70%	0.22%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.60%	0.13%	0.00%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	2.40%	89.10%	0.00%	8.53%	NA
Japonica Intermediate	241	2.50%	97.10%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	9.40%	4.17%	0.00%	NA
Intermediate	90	60.00%	36.70%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804370126	A -> T	LOC_Os08g07800.1	upstream_gene_variant ; 3487.0bp to feature; MODIFIER	silent_mutation	Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237	N	N	N	N
vg0804370126	A -> T	LOC_Os08g07810.1	upstream_gene_variant ; 896.0bp to feature; MODIFIER	silent_mutation	Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237	N	N	N	N
vg0804370126	A -> T	LOC_Os08g07790.1	downstream_gene_variant ; 4607.0bp to feature; MODIFIER	silent_mutation	Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237	N	N	N	N
vg0804370126	A -> T	LOC_Os08g07800-LOC_Os08g07810	intergenic_region ; MODIFIER	silent_mutation	Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237	N	N	N	N
vg0804370126	A -> DEL	N	N	silent_mutation	Average:39.123; most accessible tissue: Zhenshan97 root, score: 63.237	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804370126	4.24E-06	1.49E-07	mr1039	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.08E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.16E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.15E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	2.25E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	7.81E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	2.77E-43	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.50E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	5.89E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	6.34E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	5.54E-06	5.54E-06	mr1666	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.78E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	3.06E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.27E-35	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.78E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.17E-32	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	7.19E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.57E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.25E-51	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	1.68E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	2.69E-07	4.59E-10	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	8.57E-50	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	2.78E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	3.29E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	8.58E-26	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	3.80E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	9.17E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	4.47E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	2.17E-32	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804370126	NA	3.08E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251