\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804351434:

Variant ID: vg0804351434 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4351434
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAAAGCCCAACAAAAACCCAAAAACCCACCAGCCAGAGGGTTTTTCACTTTGGGTATGTTTAGTTCCCAAAAAGTTTTTTTCAAAAACATCACAT[T/C]
GAATCTTTGGGCGCTTGCATGGAGTATTGTATATAGATAAAAAGAAAAATTAATCACACAATTATGTGGGAAATCGCGAGACGAATCTTTTGAGCCTAAT

Reverse complement sequence

ATTAGGCTCAAAAGATTCGTCTCGCGATTTCCCACATAATTGTGTGATTAATTTTTCTTTTTATCTATATACAATACTCCATGCAAGCGCCCAAAGATTC[A/G]
ATGTGATGTTTTTGAAAAAAACTTTTTGGGAACTAAACATACCCAAAGTGAAAAACCCTCTGGCTGGTGGGTTTTTGGGTTTTTGTTGGGCTTTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 32.20% 1.18% 2.75% NA
All Indica  2759 91.20% 2.50% 1.81% 4.46% NA
All Japonica  1512 6.20% 93.70% 0.07% 0.07% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 90.80% 5.70% 0.84% 2.69% NA
Indica II  465 88.00% 2.80% 1.94% 7.31% NA
Indica III  913 93.60% 0.20% 1.42% 4.71% NA
Indica Intermediate  786 90.70% 2.50% 2.93% 3.82% NA
Temperate Japonica  767 3.90% 96.00% 0.00% 0.13% NA
Tropical Japonica  504 11.30% 88.70% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 61.10% 31.10% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804351434 T -> C LOC_Os08g07774.1 upstream_gene_variant ; 1373.0bp to feature; MODIFIER silent_mutation Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0804351434 T -> C LOC_Os08g07760.1 downstream_gene_variant ; 932.0bp to feature; MODIFIER silent_mutation Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0804351434 T -> C LOC_Os08g07760-LOC_Os08g07774 intergenic_region ; MODIFIER silent_mutation Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0804351434 T -> DEL N N silent_mutation Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804351434 NA 4.54E-47 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 8.03E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 1.48E-06 NA mr1176 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.44E-88 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 1.78E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 3.86E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.56E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 9.80E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 7.37E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 3.09E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 3.37E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 1.45E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 5.30E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 1.11E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 9.92E-34 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 9.74E-70 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 4.74E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 3.71E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 6.76E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 1.30E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 8.07E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.49E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 4.88E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.70E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 3.39E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.37E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 2.30E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434 NA 1.22E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251