Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804351434:

Variant ID: vg0804351434 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4351434
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAAAAGCCCAACAAAAACCCAAAAACCCACCAGCCAGAGGGTTTTTCACTTTGGGTATGTTTAGTTCCCAAAAAGTTTTTTTCAAAAACATCACAT[T/C]
GAATCTTTGGGCGCTTGCATGGAGTATTGTATATAGATAAAAAGAAAAATTAATCACACAATTATGTGGGAAATCGCGAGACGAATCTTTTGAGCCTAAT

Reverse complement sequence

ATTAGGCTCAAAAGATTCGTCTCGCGATTTCCCACATAATTGTGTGATTAATTTTTCTTTTTATCTATATACAATACTCCATGCAAGCGCCCAAAGATTC[A/G]
ATGTGATGTTTTTGAAAAAAACTTTTTGGGAACTAAACATACCCAAAGTGAAAAACCCTCTGGCTGGTGGGTTTTTGGGTTTTTGTTGGGCTTTTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	32.20%	1.18%	2.75%	NA
All Indica	2759	91.20%	2.50%	1.81%	4.46%	NA
All Japonica	1512	6.20%	93.70%	0.07%	0.07%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	90.80%	5.70%	0.84%	2.69%	NA
Indica II	465	88.00%	2.80%	1.94%	7.31%	NA
Indica III	913	93.60%	0.20%	1.42%	4.71%	NA
Indica Intermediate	786	90.70%	2.50%	2.93%	3.82%	NA
Temperate Japonica	767	3.90%	96.00%	0.00%	0.13%	NA
Tropical Japonica	504	11.30%	88.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	96.70%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	8.30%	1.04%	0.00%	NA
Intermediate	90	61.10%	31.10%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804351434	T -> C	LOC_Os08g07774.1	upstream_gene_variant ; 1373.0bp to feature; MODIFIER	silent_mutation	Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0804351434	T -> C	LOC_Os08g07760.1	downstream_gene_variant ; 932.0bp to feature; MODIFIER	silent_mutation	Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0804351434	T -> C	LOC_Os08g07760-LOC_Os08g07774	intergenic_region ; MODIFIER	silent_mutation	Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0804351434	T -> DEL	N	N	silent_mutation	Average:57.593; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804351434	NA	4.54E-47	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	8.03E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	1.48E-06	NA	mr1176	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.44E-88	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	1.78E-36	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	3.86E-31	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.56E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	9.80E-21	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	7.37E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	3.09E-45	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	3.37E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	1.45E-29	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	5.30E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	1.11E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	9.92E-34	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	9.74E-70	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	4.74E-25	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	3.71E-52	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	6.76E-21	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	1.30E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	8.07E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.49E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	4.88E-19	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.70E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	3.39E-19	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.37E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	2.30E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804351434	NA	1.22E-52	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251