\
| Variant ID: vg0804346844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4346844 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 313. )
ATCAGAATATCTACAGTCACGTGGAGAAATATTCCTAGCTAGTGTGTTGTGCTCAGATCAACTCAAGCCAATCACTGAGTATTGTAGAGTATTAATGTTC[A/T]
TTGTTTTCTTCTTTATGATGCAGGGAGCTCTACAGTAATAACATAAGCGGAACGATACCTAGTGAACTTGGAAACCTCACAAACTTGGTCAGTTTGGATT
AATCCAAACTGACCAAGTTTGTGAGGTTTCCAAGTTCACTAGGTATCGTTCCGCTTATGTTATTACTGTAGAGCTCCCTGCATCATAAAGAAGAAAACAA[T/A]
GAACATTAATACTCTACAATACTCAGTGATTGGCTTGAGTTGATCTGAGCACAACACACTAGCTAGGAATATTTCTCCACGTGACTGTAGATATTCTGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 6.20% | 1.48% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 77.10% | 18.70% | 4.30% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.40% | 0.30% | 5.35% | 0.00% | NA |
| Tropical Japonica | 504 | 43.10% | 53.20% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 5.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804346844 | A -> T | LOC_Os08g07760.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.498; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804346844 | 1.04E-06 | NA | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | 7.89E-07 | NA | mr1174 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 2.15E-06 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | 1.08E-06 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 3.33E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 3.29E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 7.52E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 2.46E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 8.93E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | 7.83E-06 | NA | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 1.61E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 1.82E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804346844 | NA | 2.69E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |