\
| Variant ID: vg0804343386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4343386 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTGGATTAGAGGGAGAAAGGAAGGAAAATAACTATGCTTTTTAACATATACTCACTTCGGTTTCATAATTCTTATCATTTTGGATAATGACATGGTTTT[C/G]
AAAATATATCTTTGACTGTATTTTTCTATTGTAATATATCTTTGACTGTATTTTTCTATTGTAATACAGTTATACTTTAACTGTAGTACTCCCTTCATCT
AGATGAAGGGAGTACTACAGTTAAAGTATAACTGTATTACAATAGAAAAATACAGTCAAAGATATATTACAATAGAAAAATACAGTCAAAGATATATTTT[G/C]
AAAACCATGTCATTATCCAAAATGATAAGAATTATGAAACCGAAGTGAGTATATGTTAAAAAGCATAGTTATTTTCCTTCCTTTCTCCCTCTAATCCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 13.90% | 1.12% | 0.59% | NA |
| All Indica | 2759 | 84.40% | 12.90% | 1.85% | 0.87% | NA |
| All Japonica | 1512 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 35.70% | 62.80% | 0.74% | 0.74% | NA |
| Indica I | 595 | 95.60% | 0.50% | 3.36% | 0.50% | NA |
| Indica II | 465 | 89.50% | 8.20% | 1.94% | 0.43% | NA |
| Indica III | 913 | 77.90% | 19.80% | 0.99% | 1.31% | NA |
| Indica Intermediate | 786 | 80.50% | 16.90% | 1.65% | 0.89% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804343386 | C -> G | LOC_Os08g07760.1 | upstream_gene_variant ; 785.0bp to feature; MODIFIER | silent_mutation | Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 | N | N | N | N |
| vg0804343386 | C -> G | LOC_Os08g07740-LOC_Os08g07760 | intergenic_region ; MODIFIER | silent_mutation | Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 | N | N | N | N |
| vg0804343386 | C -> DEL | N | N | silent_mutation | Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804343386 | NA | 3.84E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | 5.22E-06 | NA | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | 4.64E-06 | NA | mr1176 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | NA | 9.50E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | NA | 6.11E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | NA | 3.56E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | NA | 1.25E-33 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804343386 | NA | 4.90E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |