\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804343386:

Variant ID: vg0804343386 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4343386
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGGATTAGAGGGAGAAAGGAAGGAAAATAACTATGCTTTTTAACATATACTCACTTCGGTTTCATAATTCTTATCATTTTGGATAATGACATGGTTTT[C/G]
AAAATATATCTTTGACTGTATTTTTCTATTGTAATATATCTTTGACTGTATTTTTCTATTGTAATACAGTTATACTTTAACTGTAGTACTCCCTTCATCT

Reverse complement sequence

AGATGAAGGGAGTACTACAGTTAAAGTATAACTGTATTACAATAGAAAAATACAGTCAAAGATATATTACAATAGAAAAATACAGTCAAAGATATATTTT[G/C]
AAAACCATGTCATTATCCAAAATGATAAGAATTATGAAACCGAAGTGAGTATATGTTAAAAAGCATAGTTATTTTCCTTCCTTTCTCCCTCTAATCCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 13.90% 1.12% 0.59% NA
All Indica  2759 84.40% 12.90% 1.85% 0.87% NA
All Japonica  1512 96.60% 3.40% 0.00% 0.00% NA
Aus  269 35.70% 62.80% 0.74% 0.74% NA
Indica I  595 95.60% 0.50% 3.36% 0.50% NA
Indica II  465 89.50% 8.20% 1.94% 0.43% NA
Indica III  913 77.90% 19.80% 0.99% 1.31% NA
Indica Intermediate  786 80.50% 16.90% 1.65% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804343386 C -> G LOC_Os08g07760.1 upstream_gene_variant ; 785.0bp to feature; MODIFIER silent_mutation Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0804343386 C -> G LOC_Os08g07740-LOC_Os08g07760 intergenic_region ; MODIFIER silent_mutation Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0804343386 C -> DEL N N silent_mutation Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804343386 NA 3.84E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 5.22E-06 NA mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 4.64E-06 NA mr1176 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 NA 9.50E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 NA 6.11E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 NA 3.56E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 NA 1.25E-33 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386 NA 4.90E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251