\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804330490:

Variant ID: vg0804330490 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4330490
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAATTAAGCAAATTTCATAAAACCTTACTCACTCCGTCCTTAAAAAAAAACTCAATCTAGAAAGAGATGTCTAGAACAACGAATCTGGACAAAGGGT[T/C]
ACATCCCATCCTAAGTTAAGTTTTTTTTTGGGACAGAGCAAGTATGTTTTGGAATTGGAGCGCACGTCACACAAAACCCATTAAAGCTTAAACCTTATGA

Reverse complement sequence

TCATAAGGTTTAAGCTTTAATGGGTTTTGTGTGACGTGCGCTCCAATTCCAAAACATACTTGCTCTGTCCCAAAAAAAAACTTAACTTAGGATGGGATGT[A/G]
ACCCTTTGTCCAGATTCGTTGTTCTAGACATCTCTTTCTAGATTGAGTTTTTTTTTAAGGACGGAGTGAGTAAGGTTTTATGAAATTTGCTTAATTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 17.50% 1.95% 4.30% NA
All Indica  2759 95.30% 2.50% 0.69% 1.56% NA
All Japonica  1512 51.30% 48.70% 0.00% 0.07% NA
Aus  269 40.90% 0.70% 18.59% 39.78% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 97.20% 0.10% 1.20% 1.53% NA
Indica Intermediate  786 93.10% 2.30% 1.02% 3.56% NA
Temperate Japonica  767 46.50% 53.50% 0.00% 0.00% NA
Tropical Japonica  504 44.20% 55.60% 0.00% 0.20% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 8.30% 21.88% 47.92% NA
Intermediate  90 75.60% 15.60% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804330490 T -> C LOC_Os08g07730.1 downstream_gene_variant ; 722.0bp to feature; MODIFIER silent_mutation Average:54.109; most accessible tissue: Callus, score: 80.548 N N N N
vg0804330490 T -> C LOC_Os08g07740.1 downstream_gene_variant ; 3227.0bp to feature; MODIFIER silent_mutation Average:54.109; most accessible tissue: Callus, score: 80.548 N N N N
vg0804330490 T -> C LOC_Os08g07730-LOC_Os08g07740 intergenic_region ; MODIFIER silent_mutation Average:54.109; most accessible tissue: Callus, score: 80.548 N N N N
vg0804330490 T -> DEL N N silent_mutation Average:54.109; most accessible tissue: Callus, score: 80.548 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804330490 2.97E-06 NA mr1036 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 4.79E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 5.09E-08 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 3.46E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 2.42E-16 NA mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 1.05E-12 1.40E-15 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 8.78E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 4.73E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 4.79E-11 7.79E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 1.46E-08 1.46E-08 mr1347 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 3.60E-07 2.50E-08 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 7.98E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 1.06E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 7.98E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 3.72E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 5.71E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 NA 9.82E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 5.81E-12 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 1.58E-10 1.49E-11 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 1.11E-06 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804330490 2.73E-06 NA mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251