Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804315505:

Variant ID: vg0804315505 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4315505
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGGCGACCAAATGGCGGCGAGTAAGGTAGCCGTACGCGTCCTAACAATGTGACTCGTCCATAAATGGCAGCGGTTGGCAATGAATAAAACTAAAATAG[T/C,G]
AGGGAATACAACCGATAACGATGTGGTCCCAACAGAGAAAGAAACGACAACGACGAGCTCTGGTCATGAACACGACCAAGTGAGCGCGTCAAAACATGTT

Reverse complement sequence

AACATGTTTTGACGCGCTCACTTGGTCGTGTTCATGACCAGAGCTCGTCGTTGTCGTTTCTTTCTCTGTTGGGACCACATCGTTATCGGTTGTATTCCCT[A/G,C]
CTATTTTAGTTTTATTCATTGCCAACCGCTGCCATTTATGGACGAGTCACATTGTTAGGACGCGTACGGCTACCTTACTCGCCGCCATTTGGTCGCCGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	17.80%	0.51%	0.53%	G: 0.02%
All Indica	2759	96.10%	2.50%	0.58%	0.80%	NA
All Japonica	1512	49.80%	49.70%	0.53%	0.00%	NA
Aus	269	98.90%	0.00%	0.00%	0.74%	G: 0.37%
Indica I	595	94.30%	5.50%	0.17%	0.00%	NA
Indica II	465	89.70%	3.70%	2.80%	3.87%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	97.10%	2.30%	0.25%	0.38%	NA
Temperate Japonica	767	44.30%	54.90%	0.78%	0.00%	NA
Tropical Japonica	504	43.80%	55.80%	0.40%	0.00%	NA
Japonica Intermediate	241	79.70%	20.30%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	8.30%	0.00%	1.04%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804315505	T -> G	LOC_Os08g07710.1	downstream_gene_variant ; 3434.0bp to feature; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> G	LOC_Os08g07720.1	downstream_gene_variant ; 655.0bp to feature; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> G	LOC_Os08g07710-LOC_Os08g07720	intergenic_region ; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> C	LOC_Os08g07710.1	downstream_gene_variant ; 3434.0bp to feature; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> C	LOC_Os08g07720.1	downstream_gene_variant ; 655.0bp to feature; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> C	LOC_Os08g07710-LOC_Os08g07720	intergenic_region ; MODIFIER	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0804315505	T -> DEL	N	N	silent_mutation	Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804315505	2.11E-07	NA	mr1036	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	1.20E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	2.71E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	2.73E-18	NA	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	2.04E-14	3.74E-17	mr1174	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	4.04E-12	2.97E-07	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	4.84E-09	4.84E-09	mr1347	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	3.17E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	5.84E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	4.51E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	3.40E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	NA	2.34E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	7.07E-15	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	1.29E-11	2.49E-12	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	5.06E-08	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505	3.62E-07	NA	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251