\
| Variant ID: vg0804315505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4315505 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 36. )
TCCGGCGACCAAATGGCGGCGAGTAAGGTAGCCGTACGCGTCCTAACAATGTGACTCGTCCATAAATGGCAGCGGTTGGCAATGAATAAAACTAAAATAG[T/C,G]
AGGGAATACAACCGATAACGATGTGGTCCCAACAGAGAAAGAAACGACAACGACGAGCTCTGGTCATGAACACGACCAAGTGAGCGCGTCAAAACATGTT
AACATGTTTTGACGCGCTCACTTGGTCGTGTTCATGACCAGAGCTCGTCGTTGTCGTTTCTTTCTCTGTTGGGACCACATCGTTATCGGTTGTATTCCCT[A/G,C]
CTATTTTAGTTTTATTCATTGCCAACCGCTGCCATTTATGGACGAGTCACATTGTTAGGACGCGTACGGCTACCTTACTCGCCGCCATTTGGTCGCCGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.10% | 17.80% | 0.51% | 0.53% | G: 0.02% |
| All Indica | 2759 | 96.10% | 2.50% | 0.58% | 0.80% | NA |
| All Japonica | 1512 | 49.80% | 49.70% | 0.53% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 0.74% | G: 0.37% |
| Indica I | 595 | 94.30% | 5.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.70% | 3.70% | 2.80% | 3.87% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 97.10% | 2.30% | 0.25% | 0.38% | NA |
| Temperate Japonica | 767 | 44.30% | 54.90% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 43.80% | 55.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 8.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804315505 | T -> G | LOC_Os08g07710.1 | downstream_gene_variant ; 3434.0bp to feature; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> G | LOC_Os08g07720.1 | downstream_gene_variant ; 655.0bp to feature; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> G | LOC_Os08g07710-LOC_Os08g07720 | intergenic_region ; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> C | LOC_Os08g07710.1 | downstream_gene_variant ; 3434.0bp to feature; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> C | LOC_Os08g07720.1 | downstream_gene_variant ; 655.0bp to feature; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> C | LOC_Os08g07710-LOC_Os08g07720 | intergenic_region ; MODIFIER | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| vg0804315505 | T -> DEL | N | N | silent_mutation | Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804315505 | 2.11E-07 | NA | mr1036 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 1.20E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 2.71E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 2.73E-18 | NA | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 2.04E-14 | 3.74E-17 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 4.04E-12 | 2.97E-07 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 4.84E-09 | 4.84E-09 | mr1347 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 3.17E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 5.84E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 4.51E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 3.40E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | NA | 2.34E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 7.07E-15 | NA | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 1.29E-11 | 2.49E-12 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 5.06E-08 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804315505 | 3.62E-07 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |