\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804315505:

Variant ID: vg0804315505 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4315505
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGGCGACCAAATGGCGGCGAGTAAGGTAGCCGTACGCGTCCTAACAATGTGACTCGTCCATAAATGGCAGCGGTTGGCAATGAATAAAACTAAAATAG[T/C,G]
AGGGAATACAACCGATAACGATGTGGTCCCAACAGAGAAAGAAACGACAACGACGAGCTCTGGTCATGAACACGACCAAGTGAGCGCGTCAAAACATGTT

Reverse complement sequence

AACATGTTTTGACGCGCTCACTTGGTCGTGTTCATGACCAGAGCTCGTCGTTGTCGTTTCTTTCTCTGTTGGGACCACATCGTTATCGGTTGTATTCCCT[A/G,C]
CTATTTTAGTTTTATTCATTGCCAACCGCTGCCATTTATGGACGAGTCACATTGTTAGGACGCGTACGGCTACCTTACTCGCCGCCATTTGGTCGCCGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 17.80% 0.51% 0.53% G: 0.02%
All Indica  2759 96.10% 2.50% 0.58% 0.80% NA
All Japonica  1512 49.80% 49.70% 0.53% 0.00% NA
Aus  269 98.90% 0.00% 0.00% 0.74% G: 0.37%
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 89.70% 3.70% 2.80% 3.87% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 97.10% 2.30% 0.25% 0.38% NA
Temperate Japonica  767 44.30% 54.90% 0.78% 0.00% NA
Tropical Japonica  504 43.80% 55.80% 0.40% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 8.30% 0.00% 1.04% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804315505 T -> G LOC_Os08g07710.1 downstream_gene_variant ; 3434.0bp to feature; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> G LOC_Os08g07720.1 downstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> G LOC_Os08g07710-LOC_Os08g07720 intergenic_region ; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> C LOC_Os08g07710.1 downstream_gene_variant ; 3434.0bp to feature; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> C LOC_Os08g07720.1 downstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> C LOC_Os08g07710-LOC_Os08g07720 intergenic_region ; MODIFIER silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N
vg0804315505 T -> DEL N N silent_mutation Average:71.73; most accessible tissue: Zhenshan97 flower, score: 85.885 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804315505 2.11E-07 NA mr1036 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 1.20E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 2.71E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 2.73E-18 NA mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 2.04E-14 3.74E-17 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 4.04E-12 2.97E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 4.84E-09 4.84E-09 mr1347 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 3.17E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 5.84E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 4.51E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 3.40E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 NA 2.34E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 7.07E-15 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 1.29E-11 2.49E-12 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 5.06E-08 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315505 3.62E-07 NA mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251