\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804314979:

Variant ID: vg0804314979 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4314979
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACTGATAGATGAAAATCCGATCCATCAATTCTGAACCGATACCCGTTTCATATTTTTATGGTCTCAATATTATGTGAGTGGTCTAGGAGCATGGTT[A/G]
GGCTGAATTAGAAAGGAATAGTGCCCAAGGCACTGTTCATTGTCTTCCCTAGCCGAAGCCGGAAAATAAAAGAGGAGGGAAGAAGGGCACTGTGCTCCAG

Reverse complement sequence

CTGGAGCACAGTGCCCTTCTTCCCTCCTCTTTTATTTTCCGGCTTCGGCTAGGGAAGACAATGAACAGTGCCTTGGGCACTATTCCTTTCTAATTCAGCC[T/C]
AACCATGCTCCTAGACCACTCACATAATATTGAGACCATAAAAATATGAAACGGGTATCGGTTCAGAATTGATGGATCGGATTTTCATCTATCAGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 17.80% 0.21% 0.00% NA
All Indica  2759 97.40% 2.50% 0.07% 0.00% NA
All Japonica  1512 49.70% 49.80% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.30% 0.13% 0.00% NA
Temperate Japonica  767 44.10% 55.10% 0.78% 0.00% NA
Tropical Japonica  504 43.80% 55.80% 0.40% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804314979 A -> G LOC_Os08g07710.1 downstream_gene_variant ; 2908.0bp to feature; MODIFIER silent_mutation Average:62.47; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N
vg0804314979 A -> G LOC_Os08g07720.1 downstream_gene_variant ; 1181.0bp to feature; MODIFIER silent_mutation Average:62.47; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N
vg0804314979 A -> G LOC_Os08g07710-LOC_Os08g07720 intergenic_region ; MODIFIER silent_mutation Average:62.47; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804314979 A G 0.02 0.03 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804314979 2.75E-07 NA mr1036 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 9.90E-06 9.48E-06 mr1036 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 4.19E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 1.11E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 6.27E-17 NA mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 3.94E-14 1.13E-16 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 8.74E-06 NA mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 3.78E-11 1.93E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 6.92E-09 6.93E-09 mr1347 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 4.40E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 5.60E-07 mr1510 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 4.93E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 4.85E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 NA 1.50E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 3.08E-11 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 8.66E-10 6.86E-11 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 2.53E-06 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 1.95E-06 NA mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804314979 7.04E-06 7.04E-06 mr1806_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251