\
| Variant ID: vg0804312174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4312174 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )
ATACCCTGCTTTGACACCTAAAGAGGACCTTTGAGAAGTCAGAGCTACCGTATCGAGCTAGCGTTCAACGAGCTGTTGGCAACAATGACTAGAAGGGTTC[T/C]
GCTTAGTTTCAAGCAGGGTTTGGTTGTTGTCTTCTAAGTCAGAGCTGCAGCACTTTTGCGAGCTCGCCAACGATGACCGAAGTCTACAAGGCTCATCAGT
ACTGATGAGCCTTGTAGACTTCGGTCATCGTTGGCGAGCTCGCAAAAGTGCTGCAGCTCTGACTTAGAAGACAACAACCAAACCCTGCTTGAAACTAAGC[A/G]
GAACCCTTCTAGTCATTGTTGCCAACAGCTCGTTGAACGCTAGCTCGATACGGTAGCTCTGACTTCTCAAAGGTCCTCTTTAGGTGTCAAAGCAGGGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.10% | 18.70% | 0.08% | 0.04% | NA |
| All Indica | 2759 | 95.90% | 4.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 50.30% | 49.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 88.80% | 11.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 45.10% | 54.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.00% | 55.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804312174 | T -> C | LOC_Os08g07710.1 | downstream_gene_variant ; 103.0bp to feature; MODIFIER | silent_mutation | Average:65.958; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0804312174 | T -> C | LOC_Os08g07720.1 | downstream_gene_variant ; 3986.0bp to feature; MODIFIER | silent_mutation | Average:65.958; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0804312174 | T -> C | LOC_Os08g07710-LOC_Os08g07720 | intergenic_region ; MODIFIER | silent_mutation | Average:65.958; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0804312174 | T -> DEL | N | N | silent_mutation | Average:65.958; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804312174 | 2.47E-07 | NA | mr1036 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 5.01E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 5.57E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 8.96E-18 | NA | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 2.04E-14 | 3.74E-17 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 6.02E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 1.17E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 9.85E-12 | 2.81E-07 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 4.84E-09 | 4.84E-09 | mr1347 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 1.92E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 9.28E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 1.54E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 3.91E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | NA | 7.58E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 1.21E-14 | NA | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 1.29E-11 | 2.49E-12 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 2.28E-07 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804312174 | 3.62E-07 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |