| Variant ID: vg0804311130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4311130 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 100. )
GAGCACACAAGGCATGAGAAGGTTAGAGTGCTAATCAAATGCCAGTTGTTAAGGTTACATGACTAATTGGTCTCTAAAACTAGAGGATTTTAATGGAAAA[A/G]
CTATGAAAGGAATACAAAAGTTAATACTACCTCCATATTTTAATGTATGACACCGTTGATTTTTTGTCCAACGTTTAACCATTCGTCATCATTTATTTTA
TAAAATAAATGATGACGAATGGTTAAACGTTGGACAAAAAATCAACGGTGTCATACATTAAAATATGGAGGTAGTATTAACTTTTGTATTCCTTTCATAG[T/C]
TTTTCCATTAAAATCCTCTAGTTTTAGAGACCAATTAGTCATGTAACCTTAACAACTGGCATTTGATTAGCACTCTAACCTTCTCATGCCTTGTGTGCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 25.20% | 20.17% | 15.83% | NA |
| All Indica | 2759 | 43.50% | 12.50% | 23.20% | 20.77% | NA |
| All Japonica | 1512 | 24.90% | 54.10% | 14.42% | 6.55% | NA |
| Aus | 269 | 57.60% | 1.50% | 24.16% | 16.73% | NA |
| Indica I | 595 | 34.30% | 5.90% | 45.21% | 14.62% | NA |
| Indica II | 465 | 43.40% | 12.00% | 23.01% | 21.51% | NA |
| Indica III | 913 | 49.00% | 16.30% | 8.76% | 25.96% | NA |
| Indica Intermediate | 786 | 44.10% | 13.50% | 23.41% | 18.96% | NA |
| Temperate Japonica | 767 | 20.60% | 56.80% | 17.73% | 4.82% | NA |
| Tropical Japonica | 504 | 22.00% | 65.50% | 7.74% | 4.76% | NA |
| Japonica Intermediate | 241 | 44.80% | 21.60% | 17.84% | 15.77% | NA |
| VI/Aromatic | 96 | 63.50% | 8.30% | 8.33% | 19.79% | NA |
| Intermediate | 90 | 44.40% | 17.80% | 24.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804311130 | A -> G | LOC_Os08g07710.1 | upstream_gene_variant ; 654.0bp to feature; MODIFIER | silent_mutation | Average:33.233; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804311130 | A -> G | LOC_Os08g07700-LOC_Os08g07710 | intergenic_region ; MODIFIER | silent_mutation | Average:33.233; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0804311130 | A -> DEL | N | N | silent_mutation | Average:33.233; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804311130 | 2.02E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 1.41E-15 | 5.10E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 4.53E-14 | 2.79E-17 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 8.53E-11 | 1.66E-08 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 1.26E-08 | 1.26E-08 | mr1347 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | NA | 1.77E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 2.10E-11 | NA | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 1.18E-12 | 5.36E-13 | mr1174_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 1.95E-06 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804311130 | 3.24E-07 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |