\
| Variant ID: vg0804309312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4309312 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, T: 0.22, others allele: 0.00, population size: 109. )
ATGATTTGTGCTTCAGCATGATATGTCAACATGTTTATTTTTCTTTGATTGCTGTATTGTAGATGGATAAGACGACCAAGTTTTAATTTTTGTTGCTGCT[T/G]
CAAATATATTATTGTCGATGATGACCATGATTATTCAGTGTAGGAAAAGAAAGAGAGGTGCAAGGAAGGGAACTCCTCCCTCTAGCTTCCCCTCCCCCAC
GTGGGGGAGGGGAAGCTAGAGGGAGGAGTTCCCTTCCTTGCACCTCTCTTTCTTTTCCTACACTGAATAATCATGGTCATCATCGACAATAATATATTTG[A/C]
AGCAGCAACAAAAATTAAAACTTGGTCGTCTTATCCATCTACAATACAGCAATCAAAGAAAAATAAACATGTTGACATATCATGCTGAAGCACAAATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 25.00% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.20% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 46.00% | 53.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 83.80% | 15.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 43.40% | 56.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 21.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804309312 | T -> G | LOC_Os08g07700.1 | upstream_gene_variant ; 4616.0bp to feature; MODIFIER | silent_mutation | Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
| vg0804309312 | T -> G | LOC_Os08g07710.1 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
| vg0804309312 | T -> G | LOC_Os08g07700-LOC_Os08g07710 | intergenic_region ; MODIFIER | silent_mutation | Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804309312 | 5.20E-06 | NA | mr1036 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 9.35E-06 | 6.89E-06 | mr1036 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 3.98E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 8.60E-17 | 6.93E-10 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 2.66E-15 | 5.00E-18 | mr1174 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 4.08E-12 | 1.41E-09 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 1.11E-09 | 1.11E-09 | mr1347 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | NA | 2.79E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 1.82E-10 | NA | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 4.19E-11 | 7.31E-12 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 8.77E-06 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804309312 | 2.66E-06 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |