Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804309312:

Variant ID: vg0804309312 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4309312
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, T: 0.22, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATGATTTGTGCTTCAGCATGATATGTCAACATGTTTATTTTTCTTTGATTGCTGTATTGTAGATGGATAAGACGACCAAGTTTTAATTTTTGTTGCTGCT[T/G]
CAAATATATTATTGTCGATGATGACCATGATTATTCAGTGTAGGAAAAGAAAGAGAGGTGCAAGGAAGGGAACTCCTCCCTCTAGCTTCCCCTCCCCCAC

Reverse complement sequence

GTGGGGGAGGGGAAGCTAGAGGGAGGAGTTCCCTTCCTTGCACCTCTCTTTCTTTTCCTACACTGAATAATCATGGTCATCATCGACAATAATATATTTG[A/C]
AGCAGCAACAAAAATTAAAACTTGGTCGTCTTATCCATCTACAATACAGCAATCAAAGAAAAATAAACATGTTGACATATCATGCTGAAGCACAAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	25.00%	0.30%	0.00%	NA
All Indica	2759	87.40%	12.20%	0.40%	0.00%	NA
All Japonica	1512	46.00%	53.90%	0.13%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	93.80%	6.10%	0.17%	0.00%	NA
Indica II	465	88.00%	11.20%	0.86%	0.00%	NA
Indica III	913	83.80%	15.80%	0.44%	0.00%	NA
Indica Intermediate	786	86.40%	13.40%	0.25%	0.00%	NA
Temperate Japonica	767	43.40%	56.60%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.20%	0.00%	NA
Japonica Intermediate	241	78.40%	21.20%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804309312	T -> G	LOC_Os08g07700.1	upstream_gene_variant ; 4616.0bp to feature; MODIFIER	silent_mutation	Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359	N	N	N	N
vg0804309312	T -> G	LOC_Os08g07710.1	upstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359	N	N	N	N
vg0804309312	T -> G	LOC_Os08g07700-LOC_Os08g07710	intergenic_region ; MODIFIER	silent_mutation	Average:58.589; most accessible tissue: Zhenshan97 flower, score: 82.359	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804309312	5.20E-06	NA	mr1036	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	9.35E-06	6.89E-06	mr1036	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	3.98E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	8.60E-17	6.93E-10	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	2.66E-15	5.00E-18	mr1174	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	4.08E-12	1.41E-09	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	1.11E-09	1.11E-09	mr1347	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	NA	2.79E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	1.82E-10	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	4.19E-11	7.31E-12	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	8.77E-06	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309312	2.66E-06	NA	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251