\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804298332:

Variant ID: vg0804298332 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4298332
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTCGTTTAATCAGTAAGGTTGTATTTAGTTTCACACCAAAATTGGAAGTTTGAAGAAATTGGAATAATGTGACGGAAAAGTTGGAAGTTTGTGTGTAG[G/A]
AAAGTTCGATGTGACGGAAAAGTTGAAAGTTTGAAGAAAACATGTTGGAATCTAAACAGGGCCTAAGTCTGGTAATTTGAAACAAGGTCATCTTTAGTTT

Reverse complement sequence

AAACTAAAGATGACCTTGTTTCAAATTACCAGACTTAGGCCCTGTTTAGATTCCAACATGTTTTCTTCAAACTTTCAACTTTTCCGTCACATCGAACTTT[C/T]
CTACACACAAACTTCCAACTTTTCCGTCACATTATTCCAATTTCTTCAAACTTCCAATTTTGGTGTGAAACTAAATACAACCTTACTGATTAAACGAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 38.60% 0.21% 7.49% NA
All Indica  2759 82.60% 13.00% 0.22% 4.17% NA
All Japonica  1512 5.90% 94.00% 0.00% 0.13% NA
Aus  269 39.40% 0.70% 1.12% 58.74% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 79.40% 12.70% 0.43% 7.53% NA
Indica III  913 80.70% 15.30% 0.11% 3.83% NA
Indica Intermediate  786 78.90% 15.00% 0.38% 5.73% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 10.90% 88.90% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 13.50% 1.04% 69.79% NA
Intermediate  90 52.20% 34.40% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804298332 G -> A LOC_Os08g07690.1 upstream_gene_variant ; 2221.0bp to feature; MODIFIER silent_mutation Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0804298332 G -> A LOC_Os08g07670.1 downstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0804298332 G -> A LOC_Os08g07680.1 downstream_gene_variant ; 595.0bp to feature; MODIFIER silent_mutation Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0804298332 G -> A LOC_Os08g07680-LOC_Os08g07690 intergenic_region ; MODIFIER silent_mutation Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0804298332 G -> DEL N N silent_mutation Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804298332 NA 1.96E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332 NA 1.08E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332 NA 7.31E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332 1.31E-06 2.92E-12 mr1827 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332 NA 2.02E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332 NA 1.00E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251