\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804126025:

Variant ID: vg0804126025 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4126025
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCTAAATGTTTCACGCCTTGCAGGCCTCGAGTTCAGCCTTCATGTGTTGTAAAACCTTGCAGTTCGTTAGGGAGTGATTGGTTGTCTTGTGAATGACA[C/A]
ATCAAGCTGTAGATCTCTAAGGAGTTGTCCTCGTGGGTACTTGATTCCTAGTGGATAGGTGGGTTTTGGCCGCCTGAGGTCTTCTCCCATATGTTGTCAT

Reverse complement sequence

ATGACAACATATGGGAGAAGACCTCAGGCGGCCAAAACCCACCTATCCACTAGGAATCAAGTACCCACGAGGACAACTCCTTAGAGATCTACAGCTTGAT[G/T]
TGTCATTCACAAGACAACCAATCACTCCCTAACGAACTGCAAGGTTTTACAACACATGAAGGCTGAACTCGAGGCCTGCAAGGCGTGAAACATTTAGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.00% 2.30% 0.74% 17.90% NA
All Indica  2759 66.60% 4.00% 1.05% 28.34% NA
All Japonica  1512 96.30% 0.00% 0.33% 3.37% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 46.20% 3.50% 2.18% 48.07% NA
Indica II  465 91.20% 1.70% 0.22% 6.88% NA
Indica III  913 59.90% 6.40% 1.10% 32.64% NA
Indica Intermediate  786 75.20% 3.10% 0.64% 21.12% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 89.10% 0.00% 0.99% 9.92% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 0.00% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804126025 C -> A LOC_Os08g07360.1 upstream_gene_variant ; 2379.0bp to feature; MODIFIER silent_mutation Average:40.313; most accessible tissue: Callus, score: 75.432 N N N N
vg0804126025 C -> A LOC_Os08g07370.1 downstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:40.313; most accessible tissue: Callus, score: 75.432 N N N N
vg0804126025 C -> A LOC_Os08g07360-LOC_Os08g07370 intergenic_region ; MODIFIER silent_mutation Average:40.313; most accessible tissue: Callus, score: 75.432 N N N N
vg0804126025 C -> DEL N N silent_mutation Average:40.313; most accessible tissue: Callus, score: 75.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804126025 8.62E-07 8.59E-07 mr1340 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804126025 4.72E-06 4.72E-06 mr1340 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804126025 NA 5.26E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804126025 3.45E-06 NA mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251