\
| Variant ID: vg0804124681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4124681 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 200. )
CGGTTAATCTTTGCCGTTTTGCGCTGAAAAACGGTCGTGCTTCTCCATAAAAGCGAGGAGGTTATCCTTTGCTAGTTTGTTCAAAAACTAGTTGTTCGTC[A/G]
TCACGTAAGTACGATATCTATTTTCTTTGCTAATTTGTGTGTAAAATAGTCGCTTGATTCCGCGAAAGTGAATTATTCTTGAGAAATCGGTTTCACTAGC
GCTAGTGAAACCGATTTCTCAAGAATAATTCACTTTCGCGGAATCAAGCGACTATTTTACACACAAATTAGCAAAGAAAATAGATATCGTACTTACGTGA[T/C]
GACGAACAACTAGTTTTTGAACAAACTAGCAAAGGATAACCTCCTCGCTTTTATGGAGAAGCACGACCGTTTTTCAGCGCAAAACGGCAAAGATTAACCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 37.50% | 0.61% | 18.24% | NA |
| All Indica | 2759 | 20.40% | 49.90% | 1.01% | 28.60% | NA |
| All Japonica | 1512 | 94.30% | 1.70% | 0.07% | 3.90% | NA |
| Aus | 269 | 3.30% | 95.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 13.60% | 36.50% | 1.51% | 48.40% | NA |
| Indica II | 465 | 63.70% | 29.00% | 0.86% | 6.45% | NA |
| Indica III | 913 | 1.40% | 64.30% | 0.88% | 33.41% | NA |
| Indica Intermediate | 786 | 22.10% | 55.90% | 0.89% | 21.12% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.90% | 1.40% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 31.10% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804124681 | A -> G | LOC_Os08g07360.1 | upstream_gene_variant ; 1035.0bp to feature; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 76.725 | N | N | N | N |
| vg0804124681 | A -> G | LOC_Os08g07370.1 | downstream_gene_variant ; 2387.0bp to feature; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 76.725 | N | N | N | N |
| vg0804124681 | A -> G | LOC_Os08g07360-LOC_Os08g07370 | intergenic_region ; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 76.725 | N | N | N | N |
| vg0804124681 | A -> DEL | N | N | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 76.725 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804124681 | NA | 3.75E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 3.32E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 9.87E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 4.69E-17 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 2.01E-20 | mr1277_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 2.82E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 6.31E-11 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 2.53E-08 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 6.02E-08 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 1.39E-17 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 6.44E-25 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804124681 | NA | 1.58E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |