\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804124681:

Variant ID: vg0804124681 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4124681
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTTAATCTTTGCCGTTTTGCGCTGAAAAACGGTCGTGCTTCTCCATAAAAGCGAGGAGGTTATCCTTTGCTAGTTTGTTCAAAAACTAGTTGTTCGTC[A/G]
TCACGTAAGTACGATATCTATTTTCTTTGCTAATTTGTGTGTAAAATAGTCGCTTGATTCCGCGAAAGTGAATTATTCTTGAGAAATCGGTTTCACTAGC

Reverse complement sequence

GCTAGTGAAACCGATTTCTCAAGAATAATTCACTTTCGCGGAATCAAGCGACTATTTTACACACAAATTAGCAAAGAAAATAGATATCGTACTTACGTGA[T/C]
GACGAACAACTAGTTTTTGAACAAACTAGCAAAGGATAACCTCCTCGCTTTTATGGAGAAGCACGACCGTTTTTCAGCGCAAAACGGCAAAGATTAACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 37.50% 0.61% 18.24% NA
All Indica  2759 20.40% 49.90% 1.01% 28.60% NA
All Japonica  1512 94.30% 1.70% 0.07% 3.90% NA
Aus  269 3.30% 95.90% 0.00% 0.74% NA
Indica I  595 13.60% 36.50% 1.51% 48.40% NA
Indica II  465 63.70% 29.00% 0.86% 6.45% NA
Indica III  913 1.40% 64.30% 0.88% 33.41% NA
Indica Intermediate  786 22.10% 55.90% 0.89% 21.12% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 86.90% 1.40% 0.20% 11.51% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 55.60% 31.10% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804124681 A -> G LOC_Os08g07360.1 upstream_gene_variant ; 1035.0bp to feature; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 76.725 N N N N
vg0804124681 A -> G LOC_Os08g07370.1 downstream_gene_variant ; 2387.0bp to feature; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 76.725 N N N N
vg0804124681 A -> G LOC_Os08g07360-LOC_Os08g07370 intergenic_region ; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 76.725 N N N N
vg0804124681 A -> DEL N N silent_mutation Average:26.871; most accessible tissue: Callus, score: 76.725 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804124681 NA 3.75E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 3.32E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 9.87E-07 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 4.69E-17 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 2.01E-20 mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 2.82E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 6.31E-11 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 2.53E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 6.02E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 1.39E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 6.44E-25 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681 NA 1.58E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251