\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804123261:

Variant ID: vg0804123261 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4123261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTGCATCCAGCGTACAGAGGCGTCTCGGAATCACTTACCAACCTGCTAAACTTCATTCCATCTCTCTCATTCTAGGCTGGGTCCTCAACGTCACGTA[G/A]
CATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCACCCAATGGAGAAGGTATAAGCATGTCATGCTCATCTTCATCTTCCTGATTATGTGCA

Reverse complement sequence

TGCACATAATCAGGAAGATGAAGATGAGCATGACATGCTTATACCTTCTCCATTGGGTGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATG[C/T]
TACGTGACGTTGAGGACCCAGCCTAGAATGAGAGAGATGGAATGAAGTTTAGCAGGTTGGTAAGTGATTCCGAGACGCCTCTGTACGCTGGATGCAAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 33.70% 15.68% 4.17% NA
All Indica  2759 25.10% 43.70% 26.35% 4.82% NA
All Japonica  1512 94.30% 1.70% 0.07% 3.97% NA
Aus  269 3.70% 95.50% 0.37% 0.37% NA
Indica I  595 18.20% 32.30% 48.91% 0.67% NA
Indica II  465 65.80% 19.60% 14.62% 0.00% NA
Indica III  913 8.30% 56.80% 25.85% 8.98% NA
Indica Intermediate  786 25.80% 51.40% 16.79% 5.98% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 1.40% 0.20% 11.71% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 13.50% 84.40% 2.08% 0.00% NA
Intermediate  90 56.70% 28.90% 11.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804123261 G -> A LOC_Os08g07350.1 upstream_gene_variant ; 4883.0bp to feature; MODIFIER silent_mutation Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0804123261 G -> A LOC_Os08g07370.1 downstream_gene_variant ; 3807.0bp to feature; MODIFIER silent_mutation Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0804123261 G -> A LOC_Os08g07360.1 intron_variant ; MODIFIER silent_mutation Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0804123261 G -> DEL N N silent_mutation Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804123261 NA 3.05E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 1.82E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 4.76E-19 mr1874 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 4.13E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 1.30E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 4.72E-24 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261 NA 1.67E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251