\
| Variant ID: vg0804123261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4123261 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 200. )
GCTTTGCATCCAGCGTACAGAGGCGTCTCGGAATCACTTACCAACCTGCTAAACTTCATTCCATCTCTCTCATTCTAGGCTGGGTCCTCAACGTCACGTA[G/A]
CATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCACCCAATGGAGAAGGTATAAGCATGTCATGCTCATCTTCATCTTCCTGATTATGTGCA
TGCACATAATCAGGAAGATGAAGATGAGCATGACATGCTTATACCTTCTCCATTGGGTGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATG[C/T]
TACGTGACGTTGAGGACCCAGCCTAGAATGAGAGAGATGGAATGAAGTTTAGCAGGTTGGTAAGTGATTCCGAGACGCCTCTGTACGCTGGATGCAAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.40% | 33.70% | 15.68% | 4.17% | NA |
| All Indica | 2759 | 25.10% | 43.70% | 26.35% | 4.82% | NA |
| All Japonica | 1512 | 94.30% | 1.70% | 0.07% | 3.97% | NA |
| Aus | 269 | 3.70% | 95.50% | 0.37% | 0.37% | NA |
| Indica I | 595 | 18.20% | 32.30% | 48.91% | 0.67% | NA |
| Indica II | 465 | 65.80% | 19.60% | 14.62% | 0.00% | NA |
| Indica III | 913 | 8.30% | 56.80% | 25.85% | 8.98% | NA |
| Indica Intermediate | 786 | 25.80% | 51.40% | 16.79% | 5.98% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 1.40% | 0.20% | 11.71% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 13.50% | 84.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 28.90% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804123261 | G -> A | LOC_Os08g07350.1 | upstream_gene_variant ; 4883.0bp to feature; MODIFIER | silent_mutation | Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0804123261 | G -> A | LOC_Os08g07370.1 | downstream_gene_variant ; 3807.0bp to feature; MODIFIER | silent_mutation | Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0804123261 | G -> A | LOC_Os08g07360.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0804123261 | G -> DEL | N | N | silent_mutation | Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804123261 | NA | 3.05E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 1.82E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 4.76E-19 | mr1874 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 4.13E-16 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 1.30E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 4.72E-24 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804123261 | NA | 1.67E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |